 |
|
ENVIS
Forestry Bulletin |
VOL-7,NO.-1; YEAR-2007 |
TREE IMPROVEMENT IN FORESTRY: CHALLENGES, SCOPE AND STRATEGIES
A. K. Mandal, P. H. Chawhaan* and Ashok Kumar**
VI/Forest Research Institute, Dehradun 248 006
Introduction
E
ver-increasing population and rapid decrease in the forest cover is creating environmental,
ecological and economic disturbances with
irreversible consequences. In India, for fuel wood purpose alone 201 million tonnes of
wood is required against the production of 113 million tonnes (Rai and Chakrabarti, 2001). Similarly, 27.50 million m3 industrial round wood is required annually against the supply of 15 million m3 (Chadha et al., 1992). The demand is likely to increase with increasing rate of literacy, liberalization of economic policies and advancement of utilization technology. It is projected that by 2010 the demand for various Indian wood based industries would be about 44 million m3. Further, the problem has been grim due to lower productivity of Indian forests of 0.5 to 0.7 m3ha-1yr-1 against world average of 2.5m3ha-1yr-1 (Food and Agriculture Organisation of the United Nations, 1993). Different afforestation and reforestation activities need to be carried out only with genetically improved planting material coupled with clonal forestry. Short rotation forest tree species like Eucalyptus, Gmelina, Populus, Acacia, Casuraina and other species of this category have potential to play a complementary role in bridging the gap between demand and supply.
Tree improvement / breeding programme primarily consist
of selection of phenotypically superior trees to be used as parents, utilizing desirable genes,
mass multiplication of improved planting materials, and maintaining a population with broad
genetic base for advanced generation breeding. Maximum gains can easily be achieved by the
judicious use of promising trees to supply planting stock in operational forestry programme,
as most of the tree improvement programme are operated upon following two objectives:
a. Immediate genetic gain in terms of better quality, wide adaptability and higher productivity of planting stock.
b. Maintaining broad genetic base for continued improvement over many generations.
Variability in Base Population
Success to a breeding approach largely depends on the
extent of variability present in the base population. Hence, without sufficient variability for
economically desirable traits, an attempt to use genetics and breeding for forest tree improveme
nt will be a failure. The large variation has been proved to exist among different forest tree
species, races and individuals within and between the species. Zobel and Talbert (1984)
suggested that there could be three main causes for differences among the trees: (a) the
differing environment in which trees are grown, (b) genetic differences among the trees and
(c) interactions between genotypes and environment. Some genetic variations are predictable
and useful, whereas other are random and are more difficult for tree breeders to use.
In forest trees, kind of variation exists and can be grouped into geographic sources like
provenances, stands, sites and races. Geographic variations are often most important for
characters like survival and adaptability (cold hardiness), whereas for economic characteristics
such as growth traits, stem straightness, wood specific gravity, individual tree variability
have greater importance. Though large genetic variation reported in forest species are
due to wide geographical distribution and has not been fully utilized for genetic improvement.
Selection of Plus Trees
The selection of plus trees is to be carried out in
a base population, which should have wide genetic base. Advanced generation selection is made
from populations that are raised from genetic tests. Intra and inter family selection are
usually made to choose superior individuals for advanced generation selection (Fig.1). Wild
populations and natural stands or unimproved plantations are used to make first generation
selection of plus trees.
There are two main kinds of forest stands generally used for selection of superior individuals in first generation selection system.
Fig. 1. Plus trees of Gmelina arborea and Eucalyptus
Selection from Even Aged Stands
Careful selection of base population would be helpful
to account for phenotypic effects caused due to genes the individual carries. The individuals
in the even aged natural stands composed of single species show their responses mainly to genes.
As a result the relative expression of growth, form, disease resistance, adaptability, etc.
is not confounded with age effects. Trees in such stands are found to grow under conditions
similar to those that will be faced when improved planting stock will be planted in commercial
plantations. The plantations where the age, spacing and cultural practices are same are the most
useful base population for selection of individual trees as the relative expression of trait
will not be confounded with age and cultural conditions. In view of less or uniform competition,
the genetic effects (heritability) will be more pronounced. Therefore, plantations are
preferable to natural stands for selection of plus trees of first generation improvement
provided plantation of known seed sources are available. Search to locate superior trees
should be concentrated in stands and plantations that are average to better in growth, stem
form, pruning ability, bole straightness, branch angle and other traits of importance (Fig. 2).
Fig. 2. Improvement through selection of plus trees
Prior to selection, information related to
adaptability and other quality of the seed source used to raise the plantations should be
obtained. As a rule of thumb, selection should not be made from plantations raised from seed
sources known to be of poor adaptability. Tree should be selected which are reproductively
matured. Generally trees, which have attended half rotation age, are considered for selection.
However, care should be taken to avoid over matured trees or trees which have crossed the
rotation age.
Selection should not be made from the stands, which
have been logged for poles or pilling or that have been graded or thinned for above purpose.
Selection should also be avoided in stands, as far as possible, which are not pure in species
composition. There is no minimum size of a stand or plantation in which a candidate tree is
to be located. However, the stand should be large enough to locate minimum required number of
comparison trees in addition to candidate tree. To minimize the possibility of selecting
candidate trees that are related by descent, only one tree should be selected from any small
natural stand. Such restriction does not apply in case of plantations.
Selection from Uneven Aged and Mixed Species Stands
Since the trees in uneven stands differ in age and
there is tendency for storied age class, the characters of interest cannot be compared.
Selection is generally avoided in uneven aged stands. However, such standsare used in the
absence of even aged stands. In mixed stands, trees are found scattered in the whole area
and grow under different environments. The selection methods such as regression and base
value method are found to be suitable in such cases.
Selection Methods
The following methods are generally used for selection
of phenotypically superior trees under different situations. Careful search is made by competent
selection team for locating candidate tree.
Comparison tree method
This method is also known as point grading method,
where candidate tree is compared with at least five check trees for different characters
considered for selection and accordingly candidate tree is awarded points for each character.
In this method, some characters like height, clear bole height, and diameter at breast height
are actually measured on candidate and comparison trees, whereas some characters like branching
habits, apical dominance, crown formation, pruning ability are subjectively scored in relation
to check trees by visual observations. Bole straightness, and disease and insect incidence are
subjectively scored on candidate tree only.
In this method, observations on the characteristics
of economic importance are recorded on candidate tree and comparison trees. The comparison
trees are the next best trees in the vicinity of candidate trees. In other words, like candidate
tree comparison trees must have dominant or co-dominant characters. The method used for
selection of comparison trees is the same as used for candidate tree. Comparison trees may be
found at different distances from the candidate tree. The distances reported for comparison
trees are 25-50 meters. The important point is that comparison trees should be selected on a
site and under an environment similar or better to the candidate tree. In case, a candidate
tree is located on sloppy land, the comparison trees should also be selected on similar contour.
A few characters like plant height, clear bole height, diameter at breast height, volume and wood specific gravity are measured actually for candidate and comparison trees (objective grading). Bole straightness, disease and insect resistance, pruning ability, flowering and fruiting, crown conformation, etc. are subjectively scored. Candidate trees can also be scored for important quantitative characters on the basis of their percent superiority over average of check trees.
No tree should be selected, if it is found to be infested by serious diseases or insects. For analysis of wood characteristics 2 mm bark-to-bark increment core should be extracted. A large core of about 8 to 10 mm in diameter should be taken for analysis of tracheary elements and fibre length, if included for selection. The comparison tree or grading method described above is suitable for selection of plus tree in timber yielding species. However, depending on differing emphasis for different characteristics in different species, different grading sheets with different weightage should be developed.
Regression method
This method is used for selection of individuals in uneven aged or mixed species stands. The regression line is prepared by plotting the observations recorded on traits of economic interest against age of the tree. A regression curve for height or volume can be prepared with 50 trees. Sometimes determining age is difficult, as some species do not depict clear cut growth rings. Regression lines are prepared for each trait, and for each stand and region. The position of placement of point on the regression line for candidate tree determines its selection or rejection as plus tree. If the candidate tree falls at some defined distance on the regression line the tree is selected. When the value of the trait falls below the minimum acceptable level, the tree is rejected.
Base value method
Base value method is used in uneven aged stands for those traits, which are not much affected by the environment including age difference among the trees because of strong genetic control of the characters such as stem straightness, branching habit, disease resistance, wood density etc. A base value (average value) for such traits is prepared for each stand. The values of candidate trees for different traits are compared and a candidate tree is either selected as plus tree or rejected.
Individual tree method
In this method, the candidate tree is evaluated and selected without making any comparison. The selection done by this method is not very effective, as the method does not take care of confounding effect of environment and genes in the development of character. There are three variations of this method;
Total score method
The scores assigned to different characters are added and the total score is used as a guide to select or reject a candidate tree. The trees having highest scores are selected as plus tree.
Independent culling method
A minimum standard is fixed for each character. The candidate tree is selected as plus tree if it meets minimum fixed standards for each trait, otherwise the candidate tree is rejected.
Selection indices method
Development of selection indices is difficult and requires detailed knowledge of economic value of the characters in addition to knowledge on the genotypic and phenotypic co-variances of the characters. If information on these aspects are available, selection indices can be developed for the selection of plus trees. The component characters are combined together into a score or index. Selection is then applied to the index as if the index is a single character. Index is derived by multiple regression equation. For two characters X and Y, the index will look like l = Px + Wpy. Where l is the index by means of which individuals are to be chosen, W is a factor by
which phenotypic value of character y is to be multiplied and Px and Py are phenotypic values measured as deviations from population mean. Though a difficult method, selection of plus tree by this method is very effective as it is based on both genetic information and economic value of a trait. However, use of selection index where economic weights are not properly assigned can lead to erroneous selection of individuals.
Marking and Numbering of Trees
Once comparison trees and candidate trees are located by team, candidate tree is marked by a band of yellow paint at breast height. After grading, second band of yellow paint or plus (+) sign is marked on the candidate tree. The plus trees selected is also given a registration number by denoting the name of the state, name of locality and serial number of trees. For example, MHAL-1, MH denotes state Maharashtra, AL denotes the locality Allapalli and 1 (one) denotes the plus tree number.
Categories of Tree
The plus trees so selected forms the base population of a first generation breeding programme. Such trees are used for establishing first generation seed orchards. After progeny testing they are used in the establishment of advanced generation production population and form a part of germplasm collection and breeding population. Progeny tested trees (elite trees) with complementary characteristics are used as parent in the controlled breeding. In view of multipurpose use of plus trees utmost care should be taken to select plus trees.
Candidate plus tree
A tree which has been selected for grading because of its desirable phenotypic attributes such as superior growth, good form, better wood quality, etc. but has not been compared with other superior trees i.e. check trees for final selection.
Comparison or check tree
Trees against which candidate plus tree is compared iscalled comparison or check tree. Such trees are located on the same stand, are nearly of same age and are growing on the same or better site as the select or plus tree. These are next best trees compared to the candidate tree.
Select, superior or plus tree
A tree that has been compared, selected and recommended for development of production and breeding populations but has not been tested for its genetic merit.
Elite tree
A tree that has been found to be genetically superior after progeny testing (genetic testing). Such tree is the most desired one for use in mass production of seeds, vegetative propagules and breeding programme.
Progeny and Clonal Trial
Progeny and clonal trials are essential part of tree improvement programme as:
1. Mass selection is carried out purely on the basis of phenotypic values and does not guarantee breeding value as a parent. However, progeny and clonal tests will enable the evaluation of performance of selected trees for their breeding value.
2. Since the objective of any breeding programme is to develop genotypes that have desired genotypic constitution as parents, progeny test will facilitate identification of different clones or parents with high general combining ability (gca).
3. Progeny and clonal tests will also be used for estimating genetic parameters other than breeding value including heritability, genetic advance and correlations among the characteristics. With the knowledge of these parameters, the effectiveness of the selection methods used for the improvement of different characteristics can be estimated.
4. Selections made through progeny and clonal testing always gives higher gains than that of the selections made from the plantations. Progeny and clonal tests are also very useful tools to make strategy for further multi generation tree improvement programme, and through these tests desired individuals will be selected and established in advanced generation seed orchards.
5. Progeny and clonal tests are the integral part of management of seed orchards. The first generation of seed orchards, which have already been established, need to be upgraded for quality seed production by culling inferior clones or progenies. This can only be done when all the clones or progenies are tested.
6. The trials established for progeny tests can easily be converted into seedling seed orchards for quick mass production of quality seeds by rouging out inferior families. This can easily be carried out by retaining only superior trees within desired families and allow them to inter-bred to produce quality seeds.
7. Trees are the long-lived plants and, therefore, a trial for appreciable length of time needs to be established so that actual trend for different characteristics among families is properly determined. However, knowledge of the nature of the relationship between juvenile and mature growth stages helps in deciding the duration of the field trial. Where such information is not available, it is desirable that progeny trial and clonal trials are designed for longer duration so that both trend of characteristics and juvenile-mature correlation is estimated.
The potential of producing of clonal planting stock are well documented. However, if the planting stock is not of good quality and multiplied before field-testing whole purpose of clonal forestry fails. The field testing of clonal material will give information about comparative performance of different clones, clonal variability, assessing clone x environmental interaction, estimating quantitative genetic parameters and demonstration of potential clonal forestry. Genetic worth of an individual line can only
be judged through genetic testing in the field. In genetic testing, it becomes imperative to test the progeny of selected materials to evaluate genetic difference among the progenies and clones. The phenotypic value (P) is the sum of genetic effect (G) and the environment in which it is grown (E). This can be described as-
P = G + E
Seeds of forest trees are used for afforestation
programme, which usually come from different sites with diverse environmental conditions.
In order to select genotypes that can be used successfully in such diverse conditions,
progeny and clonal tests need to be carried out in different environments to test genotypic
and environmental (G x E) interactions. G x E interactions are used to measure the relative
performance of inconsistency over the environments. It is also necessary that field test be
conducted over the years and environments particularly for characters that show large
year-to-year variations such as growth and resistance to diseases and pests. The results of
such trials will assist the breeders appreciably to recommend a clone or progeny for
large-scale cultivation on regional and national basis.
Progeny tests are established either by using open
pollinated seed from plus trees through which additive gene effects are estimated or from
controlled pollinated seed which gives information both on additive and non-additive
components of inheritance. Progeny trials are extremely useful for providing information on
half-sib performance of various clones used in clonal forestry and clonal seed orchard (Fig.3). It is also useful in testing the progenies of a group of parents or their crosses in providing the estimates of various genetic parameters including heritability and genetic advance. The genetic parameters can be very useful tools in predicting the amount of gain to be expected from clonal and progeny trials. The variation among progenies and clones is commonly used as an estimate of total genetic
variation and to calculate degree of genetic control to the particular trait(s)
(Hood and Libby, 1980). Similarly, among the clones, co-variance estimates between traits
can be used to understand genetic correlation between traits (Foster, 1986). Though the
selection of plus trees is carried out with high selection intensity, genetic superiority
par se needs to be estimated using analytical tools like heritability and genetic advance.
Fig. 3. Progeny trials of Gmelina arborea (left), and Tectona
grandis (right)
Genetic divergence studies are essential to
determine the genetic distance among the selected genotypes for establishing clonal/seedling
seed orchards of diverse genotypes. After obtaining information about genetic distance,
genetically diverse progenies and clones can be planted in such way that it facilitates
cross hybridization among the genotypes, which will provide quality seed with good hybrid
vigour. Estimation of broad sense heritability for various characters in Casuarina
equisetifolia showed that heritability for height was highest (86.85 per cent) and little
less (85.96 per cent) for main bole volume (Kumar, 1996). Nelson and Tauer (1987) reported
moderate clonal heritability (broad sense) in poplars for juvenile traits like height,
diameter, growth and leaf size. However, recommended narrow-sense heritability estimates
for individual growth components so that additive genetic variance associated with individual
growth components is calculated. These estimates will focus selection of those traits from
which a positive genetic response can be expected at reasonable selection intensity.
The estimates of heritability and genetic advance
are ideal once the log phase starts. However, estimates at early stage can serve as pointer
to be compared with the results obtained at later stages, and also to establish genetic
correlation. This type of study would perceptively determine whether genetic analysis at
early stage is reliable. Wright (1976) noted that in clonally propagated plants, heritability
would be more appropriate estimate, since any combination of genetic factors obtained can be
maintained by clonal propagation. Borges et al. (1980) studied the heritability of DBH in
124 half-sib families of Eucalyptus grandis at 18 and 30 months and stated that the values
varied from 0.37 to 0.59. The heritability of wood density and number of shoots per seedling
in young progeny of Eucalyptus citriodora was estimated to be 0.91 and 0.73,
respectively (de Almeida et al., 1981).
Multilocation Testing (MLT)
The MLT for clonal and progeny need to be carried out in various agro-ecological regions to facilitate screening of elite genotypes adapted to specific locations. Some of the genotypes may do well in many of the ecological regions whereas others may do well only in limited regions. To carry out this work, all the clones and progenies should be planted in MLT with a minimum of three replications and similar design of experimentation.
Though the potential of producing clonal planting
stock is well documented, if the planting stock is not of good quality and mass multiplied
before field-testing whole purpose of clone forestry may fail. Thus, planned field-testing
of vegetative propagules is necessary in order to assess real benefits of utilizing clonal
stock. The field-testing of clonal material will give comparative assessment of different
clones for various traits and productivity, and genotype x environment interaction. Thus,
the clones must be tested in an appropriate statistical design on multilocation basis.
The specific designs to test the stability and productivity of the clone functions for
trait(s) of interest and environment(s) in which the clones are tested and grown. In testing of
the clonal material following factors play an important role:
Number of Clones per Location
As clonal forestry attracts increasing interest
and begins to gain acceptance, the safety of clonal plantations is becoming a major concern
to the researchers and managers. One approach to find solution of disasters like epidemics is
to prescribe the minimum number of clones per location (Hedstrom and Krutzsch, 1982). Heybroek
(1978) reported that in a large crowned and long lived organisms like trees, the rules may be
different from those of that govern the race between pathogen epidemics and host harvest in short-rotation
plants like wheat and barley. Libby (1987) developed three general guidelines for minimum
number of clones per locations (i) mixture of large number of clones is as safe as mixture
of genetically diverse seedlings, (ii) mixture of few clones is not safe, in fact, the mixtu
re of 2 to 4 clones is often worse than monoclonal deployment and (iii) mixture of 7 to 20
clones is as safe as large number of clones.
General Purpose and Interactive Clones
It is reported that the overall test may record a
large and highly significant clone by location interaction. However, when the performance of
the clones analyzed individually, it is found that relative rank of many clones stay approx
imately constant in many of the locations. Further, some of the clones may change in their ran
king position with regard to growth performance from location to location. This leads to two c
ontrasting selection and deployment strategies, firstly to select the high performance clones w
hich are relatively stable ranked over many of the locations and deploy these for general purpo
se clones to the client areas and secondly to select among interactive clones, deploying these
clones only to those locations where their performance was out standing. The best performance
in each location is often achieved by selecting few of these interactive clones and plant on lar
ge scale. In this way, greater genetic diversity can also be maintained for future improvement a
nd danger of epidemics can also be avoided.
Clonal Forestry
Rooting of cuttings or production of few plantlets by vegetative means may be of an academic interest, production of large scale clonal planting material demands development of infrastructure for propagation so that identified biotypes are propagated in economic manner at an appropriate time. Before 1980s, mass propagation of cuttings was mostly confined to Populus and Salix species in temperate, and Cryptomeria in subtropics (Eldridge et al., 1993). However, the success in mass multiplication of eucalypts has given new dimensions to clonal forestry. By 1991, twenty companies in Brazil had operational scale clonal plantation programme producing about 50 million rooted cuttings of Eucalyptus annually for planting in an area of about 45,000 ha, representing nearly 29 per cent of the total 175 million Eucalyptus planted annually (Griffin and Rivelli, 1993). Other important countries where operational scale clonal Eucalyptus plantation programme have been developed include South Africa, France, Portugal and Spain (Lal, 1993).
In India, though considerable work to propagate
more than 220 forest species has been carried out, concerted efforts to produce large scale planting material are negligible. Success achieved in clonal planting of Eucalyptus is due to the active involvement of a private enterprise ITC Bhadrachalam Paperboards Limited, Andhra Pradesh (Lal, 1993). Promising clones of Eucalyptus resistant to leaf spot have attained mean
annual increment between 16-20 m3ha-1 yr-1 under moderate rainfall conditions at the age of 3 years against 5-6 m3ha-1 yr-1 by seedling forestry (Lal et al., 1994). Mysore Paper Mills, Karnataka, expected to plant about 60 lakh clonal plants annually of hybrid Casuarina, Acacia, Eucalyptus and Carebia honderanus. The farmers of Haryana, Punjab and Uttar Pradesh are planting about 4,000 ha poplars annually under farm forestry projects promoted by WIMCO Limited (Jones and Lal, 1989). The productivity of these plantations varies from 15 to 20 m3 ha-1yr –1.
It has obviously been a limitation in forest tree species to achieve the gains in a short span of time through breeding approaches. Further, there have been limited artificial and selection in forestry, which have not been fully exploited. Under natural selection, the survival strategy has become an over ridging factor with much of the population being poor yielder. For example, in Eucalyptus tereticornis while 91 per cent of the unproductive population contributed to only 72.40 per cent of utilizable biomass, whereas 9 per cent of the productive population contributed to as high as 41 per cent (Gurumurthi et al., 1991). Similarly, in Casuarina equisetifolia the productive male and female populations of just 10 and 5 per cent contributed to 31.68 and 21.11 per cent to the utilizable biomass, respectively (Kumar, 1996). The similar trend has been reported in a number of other important fast growing tree species including Albizia lebbek, Acacia nilotica, Cassia siamea and Prosopis juliflora (Gurumurthi et al., 1991).
In order to enhance the productivity of man made plantations in a short period, it is imperative to adopt clonal forestry by multiplying genetically improved planting stock. Improved planting stock will not only increase the productivity but also positively influence survival, disease resistance and quality. The existing variability in the base population plays a crucial role in screening the superior biotypes, as it is the platform for other components of improvement cycle viz. breeding, propagation and production populations. Implementing clonal forestry on commercial scale need to be
economically viable and increase the productivity substantially in short period. A clone development approach and clone-screening curve will be of immense use in operationlization of clonal forestry (Fig. 4).
Fig. 4. Clonal propagation of Dalbergia sissoo in mist chamber
Verma et al. (1994) derived the ‘clone development approach’ through explaining that clone is a product developed with a view of obtaining high yield at reasonable cost with specific end uses. The development effort on production of clones can add specific variants in terms of identifying clones tolerant to drought, salinity and resistance to pests and diseases, and thus can also be planned for site-specific approaches. Carefully planned development efforts are decided during clonal exploration, selection and evaluation to obtain wide range of clones. This approach can extremely be useful in maintaining genetically broad based productive clones and on the other hand eliminating inferior clones on majority count. Such a clone bank can also serve as breeding population in developing hybrids from superior parents. This can also provide opportunities for hybridization of selected individuals for specific requirements or combining ability viz., tolerance to salinity and high productivity. It does not mention any units for either time or effort, as it would vary from species to species depending on manpower,
expertise and base population availability. The experience of Aracruz Florestral, Brazil has shown that it would take about eight years in Eucalyptus. Others drawing on the experience of Aracruz can bring down the time required for commercialization. The local research required on exploration, selection, evaluation and field trials need to be carried out. It is also advisable to select locally performing superior individuals and also introduce exotic clones so that high variability is maintained (Fig. 5).
The short-term strategy to increase productivity involves identification and multiplication of elite biotypes. This should run in consonance with long-term strategy of production of new recombinants through hybridization. In India, though a number of clones of various species have been identified and multiplication techniques developed, large-scale availability of quality planting material remained far from adequate.
Fig. 5. Population cycle to achieve productivity gains through clonal forestry
Large-scale production of quality planting material is possible when operational functions of various clonal propagation activities are managed properly. Only about 15 per cent of the clonal material can be used for commercial production. However, converting selected clones in to large scale plantations involves much more than the selection of few individuals based on just performance and rooting. It may be realized however that even if 10 per cent of the clones selected at the research level reach the commercial stage, the yield of man made plantations can be enhanced substantially.
The development effort on production of clones can add specific variants to understand tolerant to drought, salinity and resistance to pests and diseases, which can also be planned for site-specific approaches. Carefully planned development efforts are decided during clonal exploration, selection and evaluation to
obtain wide range of clones. This approach can be extremely useful in maintaining genetically broad based productive clones and eliminating inferior clones on majority count. Such a clone bank can also serve as breeding population in developing hybrids from superior parents. The experience of Aracruz Florestral, Brazil has shown that it would take about eight years in Eucalyptus for this process to complete. However, pro-planning and innovative approach can bring down the time required for commercialization substantially.
References
Borges, R.C.G.; Brune, A.; Silva, J.C. and Regazzi, A.J. 1980. Estimativa de parametros geneticos em Eucalyptus grandis (Hill Maiden). Revista Arvore, 4 (2):134-145.
Chadha, K. M.; Patnaik, S. S. and Gurumurthi, K. 1992. Country report – India. In: Regional review and country reports on tree breeding and propagation. FAO/UNDP Field Report No. 2. pp.49-68.
de Almeida, C.M.V.C.; Brune, A.; Silva, J.C. and de Oliveira, L.M. 1981. Estimatives de herdabilidades e correlacoes em progenies jovens de Eucalyptus citriodora Hook. Revista Arvore, 5 (1): 250-268.
Eldridge, K.G.; Davidson, J.; Harwood, C. and Wyk, van G. 1993. Eucalyptus domestication and breeding. Oxford, Clarendon Press.
Food and Agricultural Organisation of United Nations 1993. Forestry statistics today for tomorrow – wood and wood based products. Rome, Food and Agricultural Organisation of United Nations.
Foster, G.S. 1986. Provenance variation of eastern cottonwood in the lower Mississippi valley. Silvae Genetica, 35: 32-38.
Griffin, A.R. and Rivelli, J. 1993. A comment on clonal eucalyptus plantations In: Eucalyptus improvement and silviculture. IUFRO. 1p.
Gurumurthi, K.; Verma, R.K.; Ashok Kumar; Madhavi, T.S. and Thirunavoukkarasu, M. 1991. Tree Improvement strategies for increased biomass production. In: 7th Convention and Symposium’91, New Delhi, 12-13 July 1991. Bioenergy for employment generation and environmental protection: Procedings edited by H.L.Sharma and R.N. Sharma. New Delhi, Bio-Energy Society of India. pp. 27-48.
Hedstrom, B. S. and Krutzsch, P. 1982. Regulations of clonal forestry with Picea abics. In: IUFRO Joint Meeting Working Parties on Genetics about Breeding Strategies Including Multiclonal Varieties. Sensenstein. Proceedings. IUFRO.
Heybroek, H.M. 1978. Primary considerations multiplication and genetic diversity. Unasyla, 30: 27-30.
Hood, J.V. and Libby, W.J. 1980. A clonal study of intraspecific variability in radiata pine, I: cold and animal damage. Australian Forestry Research, 10: 9-20.
Jones, N. and Lal, P. 1989. Commercial poplar planting in India under agroforestry systems. Commenwealth Forestry Review, 68(1): 19-26.
Kumar, A. 1996. Genetic improvement of Casuarina equisetifolia. Ph. D. thesis. Forest Research Institute, Dehradun.
Lal, P. 1993. Economics of Clonal forestry plantations. In: ICFRE/FAO/UNDP Workshop on Production of Genetically Improved Planting Materials for Afforestation Programmes, Coimbatore, 18-25 June 1993. Proceedings edited by K. Vivekanandan, K.N. Subramanian, N.Q. Zabala and K. Gurumurthi. Los Banos, FAO. pp. 108-115.
Lal, P.; Kulkarni, H.D. and Srinivas, K. 1994. Four years of Eucalyptus improvement through clonal technology by ITC Bhadrachalam Paperboards Ltd. In: Second Asia-Pacific Conference on Agricultural Biotechnolgy, Madras. Proceedings.
Libby, W.J. 1987. Testing and deployment of genetically engineered trees. In: Bonga, J.M. and Durzen D.J. Eds. Cell and tissue culture in forestry. Lancester, Martinus Nijhoff Publishers. pp. 167-194.
Nelson, C.D. and Tauer, C.G. 1987. Genetic variation in juvenile characteristics of Populus deltoides from souther Great Plains. Silvae Genetica, 36: 216-221.
Rai, S. N. and Chakrabarti, S. K. 2001. Demand and supply of fuel wood and timber in India.Indian Forester, 127 (3): 263-279
Verma, R.K.; Ravi, N.; Jayachandran, C.K.; Ganesan, M.; Ashok Kumar; Balasu-bramanian, A. and Gurumurthi, K. 1994. Hedge orchards for clonal forestry. Coimbatore, IFGTB.
Wright, J.W. 1976. Introduction to forest genetics. New York, Academic Press.
Zobel, B.J. and Talbert, J. 1984. Applied forest tree improvement. New York, John Wiley and Sons, 505p.
|
CALENDAR OF MEETINGS
12-15 Sept 2007
European Association for Southeast Asian Studies (Euroseas) International Conference, Naples, Italy
Dr. Dario Novellino or Dr Simon Platten
Department of Anthropology Marlowe Building
University of Kent, Canterbury, Kent CT2 7NR
United Kingdom
E-mail: darionovellino@libero.it or S.J.Platten@kent.ac.uk
Website: www.kent.ac.uk/anthropology
19-21 Sept. 2007
International Conference to Promote the Development of Non-Timber Forest Products and Services, Beijing, China
ITTO Secretariat, Forest Industry Division
Tel: 81-45-223 1110
Fax: 81-45-223 1111
E-mail: fi@itto.or.jp
Website: iito.or.jp
25-28 Sept. 2007
Processing and Marketing of Teak Wood Products of Planted Forests, Peechi, Kerala, India
Convener, Regional Teak Workshop 2007
Kerala Forest Research Institute, Peechi 680 653, Kerala, India
Tel: 91-487-699037, 699061-64, 699365
Fax: 91-487-2699249 Cell: 919447878838
E_mail: kmbhat@kfri.org
Website: www.kfri.org
30 Sept. 03 Oct. 2007
Global Vision of Forestry in the 21st Century
Toronto, Canada
University of Toronto
Tel; 1-416-978 6196
Fax: 1-416-978 3834
Website:www.forestry.utoronto.ca/centennial/int_congress.htm
15-18 oct 2007
XVI International Plant Protection Congress
Glasgow, UK
Website: www.bcpc.org/japps2007
23-25 Oct. 2007
IIIrd International Symposium on Venner Processing and Products, Shanghai, China.
Changtong Mei or Xiaoyan Zhou
Tel: 86-25-8542-7079
Email: plywood@njfu.com.cn
28 Oct.- 02 Nov. 2007
Taal 2007: Conserving Lakes and wetlands for future
The XII World Lakes Conference, Jaipur, India
Ministry of Environment and Forests
Government of India, New Delhi
Website: www.taal2007.org
01 Nov. 2007
VIII Session of the Conference of the Parties to the UN Convention to Combat Desrtification, Madrid, Spain
UNCCD Secretariat
Tel: 49-228-815-2800; Fax: 49-228-815-2898
Email: secretariat@unccd.int
Website: www.unccd.int
13-15 Nov. 2007
International Confrenence on Durability of Wood-Framed Housing..Lessons Learned from Natural Disasters, Beau Rivage, Biloxi, Mississippi.
Tel: 608-231-1361, ext. 208; Fax: 608-231-2152.
Email: confrences@forestprod.org
06-08 Feb. 2008
III International Conference on Water Quality Management
Nagpur, India
Mr. G.N. Mathur, Secretary
Tel: 91-11-2611 5984/2611 1294; Fax: 91-11-2611 6347
Email: uday@cbip.org; cbip@cbip.org;
Website: http://www.cbip.org
|
TREE IMPROVEMENT FOR HIGHER GENETIC GAINS
A. K. Mandal, P. H. Chawhaan* and Ashok Kumar**
Tropical Forest Research Institute, Jabalpur-482 021
*Arid Forest Research Institute, Jodhpur-342 005
**Forest Research Institute, Dehradun- 248 006
Introduction
S
election of provenances, plus trees, standardization of mass scale
propagation techniques, testing of clones/progenies for stability and
adaptability, and releasing of superior stock for large scale planting are some of the important
genetical tools to be adopted for increasing the productivity. There are two major sources viz.
, seed production areas and seed orchards, supplying genetically improved seeds for commercial p
lantations. Degree of improvement is more in the latter than in the former and is proportiona
l to the selection differential in both the cases. Seed production areas are established from
the
existing stands selected for the phenotypic superiority of trees, rogued and managed for seed
production. However, the seed orchards are specialty plantations created to serve as seed pro
duction machine. Zobel (1993) defined seed orchard as a plantation of genetically superior tre
es isolated to reduce pollination from genetically inferior outside sources, and intensively man
aged to produce frequent, abundant, easily harvestable seed crop. A seedling seed orchard is established with seedling progeny of trees selected for desired characteristics and may be either unpedigreed (family identity if not maintained) or pedigreed. Both the orchards serve the basic purpose of providing improved seeds with a provision for forward selection. However, the pedigreed orchard plays a pivotal role in a recurrent breeding programme.
Seed Production Areas
Seed Production areas (SPA) is an important method and immediate source of well adapted and quality seeds, which are produced at moderate cost. The seeds from SPA are widely used where the improvement programme are at nascent stage and have been using seeds from unimproved or unknown sources. However, it has limited use in countries where tree improvement programme are in advanced stages. SPA is also known as seed stand. However, many workers prefer to distinguish between them.
Seed stand refers to a group of trees that has been identified and set aside for development into SPA. SPA, however, denotes the seed stand, which has been upgraded by removal of inferior trees and managed for seed production. It provides an inexpensive supplement to more elaborate and highly technical tree breeding activities. It must be emphasized that SPA are generally used as an interim source of quality seed and are phased out when better genetic seeds become available from seed orchards. The genetic gain through SPA is generally low ranging from 5 to 15 per cent depending on the species. If the original seeds are from a large genetic base better gains are expected. Seeds collected from the seed production areas generally have better adaptability, bole/crown characteristics and pest resistance. When SPA are established in natural stands, where the geographic origins of the parent is known, selection of best individuals often leads to the development of a land race. The preconditions of production of genetically improved seed are fulfilled in SPA by way of presence of phenotypically superior trees, and mating among these trees with minimal of selfing and contamination by inferior pollen from outside source (Fig.1-3).
Selection of SPA
The outstanding natural stand or plantations at good
site are usually selected for establishing SPA. The selected stand is to be fully stocked and
as far as possible should contain large number of superior trees. The stands with limited
superior trees, coppice or regenerated forests are to be avoided. The genetic gain from such
stand (if developed into SPA) will be small with a high risk of selfing in a very open stand
(after removal of inferior trees). In case of plantations that are converted to SPA, origin
of the seed from which the plantation had been developed should be known. The origin of seed is
important in order to know the genetic worth of the plantation. In SPA, there is no specific
age limit other than that the trees in the stand must have developed to proper reproductive
phase. Hence, neither too young nor old stands are selected. Older trees will not respond
to thinning and seed from older as well as from younger trees will often be inferior in quality.
Also the trees must have proven ability to produce flowers and seed in the locality especially
in case of exotics. Area that are prone to natural calamities, heavy winds, fires, etc are not
selected as that can damage the trees especially after the area has been thinned. The selected
seed stand should have good general health of the trees and the crop, and should also be free
from the diseases and pests. The area should easily be accessible even in the difficult periods
(rainy season) throughout the year so that seed extraction is carried out properly.
Methodology for SPA Establishment
1. Delineate the area (border) by poles and signboards and indicate in the forest map. The minimum area for efficient management should not be less than 3 -5 ha.
2. After an intensive survey of the plantation, three to four sample plots are randomly selected of size 50 x 50 m. In each sample plot, a ring is made in red colour at about 1 m height and numbered. All the trees are measured for height, clear bole height (CBH) and girth at breast height (GBH), and scored for straightness, pruning ability, health and crown in 10-point scale, as per point grading method (Kumar and Matharoo, 2003; Luna and Kumar, 2007).
3. Analysis of the all the plots is carried out allotting maximum of 100 points to a tree. This is called index value of an individual tree and the total of all the trees in a plot is referred as total index value. The detailed criterion for allotting scores to different traits is presented in following Table 1 and 2. On the basis of mean of the population, average index value of all the plots is compared and the plot with highest value is selected as SPA.
4. The sample plot that obtains maximum index marks is finally selected for conversion into SPA, and made as core area to be amplified equally in all the directions.
5. The boundary of the SPA is demarcated by making two bands at breast height in red colour on all surrounding trees. Area needs to be fenced with barbed wire to check physical damage that may be caused by human beings and animals, and also to make seed collection convenient. Demarcation of pollen dilution zone all along the SPA is also carried out in the same fashion.
Table 1. Criteria for scoring height, CBH and DBH
|
Superiority percentage over mean |
Score |
|
|
  Height CBH   DBH
|
|
Mean (1+20/100) |
18 18   36
|
|
Mean (1+11/100) to mean (1+20/100) |
13 13   26
|
|
Mean (1+1/100) to mean (1+10/100) |
9 9   18
|
|
Mean (1-1/100) |
5 5   10
|
|
Mean (1-20/100) to mean (1-11/100) |
1 1   2
|
|
Mean (1-20/100) |
0 0   0
|
Table 2. Criteria for straightness, pruning ability, health and crown shape
|
S.No. |
Score |
Characteristic |
|
|
|
Straightness Self pruning
Health Crown |
|
01 |
09 |
Straight Heavy
-- -- |
|
02 |
05 |
Straight but 1 bend
Moderate  Healthy
Good |
|
03 |
02 |
Straight but 2 bend
--  Moderate
-- |
|
04 |
01 |
Crooked
Poor  --
Poor |
|
05 |
00 |
Very Crooked
--  
Poor
--
|
6. Complete enumeration of entire SPA area is done by numbering, measuring and scoring all the trees for described traits as detailed in the selection of sample plots. The analysis is carried out to make a list of trees to be retained and culled.
7. Demarcate trees with a ring to be retained and with a cross to be removed. Do not select trees on an exposed border since these trees will have favorable growth conditions and will exhibit peculiar growth form (eg. wide asymmetric crown).
8. Place equal importance to both the functions of seed production area that is, the production of abundant seed and the production of improved seed through proper spacing (even distribution of trees) and optimum selection differential.
9. Remove all the trees marked for rouging irrespective of spacing. In case, natural stand is converted into SPA, remove all trees of all other species also. In essence, SPA should be composed of a single species. However, this may not always be possible
in tropical forests where species diversity is more. In such a situation, forest manager may be interested to retain maximum of two species. Such a practice may be allowed only where both the species are dominant or co-dominant, and do not interfere with each other in terms of growth, crown development, pollination, etc.
10. Retain about 100-150 superior phenotypes per hectare depending on the size of the crown. In Dalbergia sissoo, about 100 trees are retained in SPA. When several good phenotypes occur in a group, sufficient trees must be removed so that remaining trees receive enough sunlight. In an area where inferior trees are available in-group, all of them need to be removed even if this results in large open area.
Fig. 1. Seed stand selected for development in to Seed Production Area
a. Boundary of natural stand of plantation
b. Boundary of pollen dilution zone
c. Boundary of seed stand selected
Fig. 2. Seed production area after development
a. Trees retained in the seed production area
b. Trees removed
Fig. 3. Tree marked for retention (marked ring) and removal (cross marked)
11. Trees with desired qualities should only be left in SPA. Thus, care should be taken so that remaining trees are not damaged during various operations like rouging.
12. Isolate the SPA by developing pollen dilution zone in order to avoid to contamination with foreign pollen from inferior sources. A pollen dilution zone of 100 to 200 m width is always preferred. If SPA developed constitute part of a larger stand, a zone of good phenotypes should surround it, and seed of such trees should never be used for plantation purpose.
13. Collect seed at maturity only. The identity of the seed collected from individual SPA must be maintained by using proper labels and record for total seed yield in each SPA separately and also of individual trees.
Seed Orchard: A Tool for Tree Improvement
In modern forest plantation programme involving
regeneration by annual planting on a large scale, seed orchards have become an essential component of many reforestation projects. This is because seed orchards provide a continuing reliable source of genetically and physiologically improved seeds, which in return enable
the complicated schedule of operations in a reforestation programme be carried out smoothly and effectively. In tree improvement process, after rigorous species trials, provenance testing and phenotypic selection, seed orchard is the locus where the selected materials are kept, isolated and managed to produce the planting stocks of desired quantity and quality. Though modern technological tools such as micro-propagation techniques are available to produce large quantity of planting stocks, it is still much easier and cheaper to produce planting stocks through seed orchards. At the same time the orchards are able to maintain the desired genetic variability in the progenies produced.
Seed orchard is an area where seeds are mass-produced to obtain the greatest genetic gain as quickly and inexpensively as possible. Seed orchards are the plantations of selected clones or progenies, which are isolated and managed to produce frequent, abundant and easily harvested crops of seeds. In this respect, the definitions clearly indicate that seed orchard is a well-planned and managed plantation with the objective of producing large quantity of improved seeds in the cheapest and fastest manner. However, in attempting to meet the above objectives, many experiments failed because of poor planning and management of the orchard not to mention the lack of knowledge on the species requirements.
Seed orchards that are well-planned and managed (whose clones and families are properly evaluated) give good results, but their costs and absolute terms are high. Normally the cost involved in developing the required seed orchard is high and is imperative that they be associated with a large reforestation programme. With small programme, the effort expended in seed orchard development should be appropriately scaled. For example, mild selection and establishment of clonal seed orchards without progeny testing may be justifiable in a small-scale reforestation programme. In very small-scale programme, it may be more economical to import seeds from clonal seed orchards established elsewhere and create simple seedling seed orchards locally, rather than
to start a tree improvement programme for the minor species.
Assumption of Seed Orchards
The success of a seed orchard programme depends on plentiful delivery of viable seeds. The final fruit and seed yields may be influenced by breakdown of any one of the processes of pollination, pollen grain germination, pollen tube growth, fertilization and embryo development (Brown, 1990). Seed yield is also reduced if the pollen load is low. Empty seed and seed of low viability may also result from a breakdown in embryogeny. Most clonal seed orchards have been established based on some assumptions including (a) all the clones and ramets in the orchard would flower during the same period, (b) have the same cycle of periodic heavy flower production, (c) be completely inter-fertile with all its neighbors and yield identical numbers of viable seed per tree, (d) have the same levels of self-incompatibility and (e) have a similar rate of growth and crown shape as all the other trees. It is almost certain that these assumptions are not virtually satisfied fully. The assumptions of synchronization of flowering and random mating should definitely come true for a seed orchard to be successful.
Types of Seed Orchard
Basically, there are two types of seed orchard, namely clonal or vegetative seed orchard and seedling seed orchard. Clonal seed orchards are those established through the use of vegetative propagules such as grafts, cuttings, tissue culture plantlets, etc. These orchards are the most common type used operationally. The seedling seed orchards on the other hand, are established by planting seedlings followed by rouging the poorest trees, generally leaving only the best trees of the best families for seed production.
Seed Orchard Generation
Seed orchards are commonly categorized by generation
i.e. first, second or more advanced-generation dependingupon how many cycles of improvement they represented. The first-generation orchard is the result coming from the selection of, natural stands or unimproved plantation, commonly using individual tree selection method. The pedigrees of the parent trees are usually not known. The first-generation seed orchards are improved by rouging i.e. removal of less desirable genotypes from\ a number of orchards of similar geographic background and bringing them together in a new improved first-generation orchard.
Number of Clones or Families
There is no rule of thumb as to the number of clones or families that should be raised in the seed orchard. It has been an accepted fact that about 20 genotypes are sufficient to generate a progeny base broad enough to ensure adaptation of orchard strain to normal planting sites, and to avoid serious inbreeding among the genotype within the orchards. This is premised on the condition that the genotypes as much as possible will all flower in equal abundance at the same time, and the localizing of ramets or progenies in the orchard is minimized to avoid inbreeding. For practical reason, it is advantageous to establish more than 20 genotypes to allow for the loss or rejection of stock-scion incompatibility. Strategically, it is wise to include higher number of genotypes in the first generation orchard, if progeny test can be conducted to evaluate the genotypes of a younger age.
Early Full Stocking
In seed orchards establishment, securing full stocking should be the primary concern. Where the field grafting is adopted for establishment, it is advisable to plant two or three seedling stocks in close proximity at each place where a successful ramets is desired. This is to allow for grafting failures, culling of incompatible ramets, or selection of best ramets. Orchards established by using potted grafts, balled grafts or seedlings, should adopt a closer spacing to
allow for establishment losses.
Early and Abundant Flowering
Individuals selected for clonal propagation in the orchard should be sexually mature to avoid long delays and great height growth before the orchard trees flower {this is unavoidable in seedling seed orchards and orchards established with rooted cuttings from juvenile sources). Besides providing wider spacing and fertilizing in order to enhance early and abundant flowering, it is imperative for one to learn which environmental factors influence seed production. Thus, some preliminary studies on the suitability of the proposed orchard site for seed production is required.
Pollen Isolation
Complete isolation of the orchards from inferior pollens of the same or hybridizing species may not be possible. For tropical pines, it is recommended the minimum isolation distance to be 200m upwind from sources of contamination. Effective pollen dispersion distances of hardwoods are not yet well documented. Therefore, the hardwood seed orchards should as much as possible be distantly separated from sources of pollen contamination. Isolation zones are also required to protect orchards from different physiographic regions and between advanced-generation and early generation orchards. However, some species in the same genus do not need to be isolated from each other because they flower at different times and they will not cross. This is common in pines.
Orchard Size
The size of orchards to be established depends upon the extent of area to be reforested each year and anticipated annual seed yield. It is quite common for initial estimates of the required orchard area to be conservative because of under estimation of future reforestation programme and/or over estimation of seed yield. However, once suitable orchard sites have been developed, it is desirable to reserve large areas in the vicinity to develop later generation orchard, seed
extraction plants, nurseries, etc.
Seed Orchards as Clone Banks for Research
Seed orchard or clone bank are the most important and essential component for long-term tree improvement programme. It could easily be used for preserving and testing of a large number of genotypes, but not to produce large quantities of seeds for operational planting. Clone banks maintained to preserve and test large number of genotypes are of great importance for long-term tree improvement programme. Clone banks can also be considered as Research Seed Orchard (Zobel and Talbert, 1984) and seeds can be obtained. Clone banks need a broad genetic base to avoid inbreeding in future generations and to preserve genes and genotypes that might be useful as the tree improvement programme develops and are generally established close to research stations for intensive management.
Seedling Seed Orchard as Production Population
Seed orchard procedure is universally adopted to obtain assured supply of genetically improved seed at reasonable cost. The goal is to increase the frequency of favorable alleles in the selected individuals. However, if seeds of these trees are collected from their original location they may not be of very good quality. These outstanding trees in their original place of occurrence are pollinated by surrounding, often related, inferior individuals contributing undesirable alleles and deteriorating genetic quality of seeds. Establishment of seed orchard allows assemblage of several unrelated superior individuals. The mating among these individuals helps produce quality seed. Seedling seed orchards also facilitate selection and recombination between and within family, resulting in enhanced genetic gains.
Seedling seed orchards are also established from balanced mixture of seeds from several selected trees without maintaining family identity (un-pedigreed seedling seed orchard). Such orchards are relatively cheap and simple, providing fairly improved seed at early stages. On the other hand pedigreed seedling seed
orchards, as a part of long-term breeding programme, can serve as production population in each successive generation with increased genetic gain through intensive selection and breeding in each generation.
Seedling Seed Orchard and Genetic Test
Considering economics and gain per unit time from tree improvement programme, seedling seed orchards are also planned as progeny trials to meet the twin objectives of genetic testing and seed production. Progeny testing evaluates genetic worth of selected individuals through performance of their progenies derived either by incomplete or complete pedigree mating design.
First generation seed orchards are established with mass selected trees. The trees are selected purely on phenotypic basis, providing no guarantee of their genetic merit. Estimation of general combining ability of individual trees through progeny tests allows identification of genetically superior parents and inter-mating between them to produce improved seeds for plantations. Information generated through genetic tests is utilized for upgrading the production populations by removal of inferior individuals, and selecting individuals for advanced generation production populations and breeding. Complete pedigree mating is employed to obtain progenies for testing programme and helps in identification of good specific combiners. Seedling seed orchard cum progeny trial is also used to estimate genetic gain and character association, which helps in development of breeding strategy and in taking future breeding decisions.
Seedling Seed Orchard as Breeding Population
Breeding populations or breeding orchards are most important components of any long term breeding programme. They harbor most desirable combinations of genes through selection and recombination in a given population. These breeding populations are essentially seedling seed orchards. As discussed above, seedling seed orchards provide mating opportunity among diverse individuals, thereby producing favourable recombinants.
Selection is applied following recombination. The selected individuals are inter-mated to generate genetic variation. The progenies from these mating are planted in genetic tests in each generation. Once the desired information from genetic tests is obtained, they are converted to production seed orchards. Thus, a single population established per generation serves as breeding population, progeny test and ultimately a seed orchard. Since there is a danger of loss of variability and inbreeding during the process of recurrent selection, the breeding programme should start with sufficiently large entries.
Conclusion
Presently India has only 23.68 per cent of total geographical area under forest cover, which is far below the national target of 33 per cent. To make Indian forestry sustainable, vigorous efforts need to be made with massive afforestation programme, using only improved planting materials coupled with effective silvicultural management and protection. The seed orchards ensure availability of genetically improved seeds with a promise for continued genetic upgrading of the species.
References
Brown, A.H.D. 1990. Plant population genetics, breeding and genetic resources. Massachusetts, Sinauer Associates. pp 145-162.
Kumar, A.K. and Matharoo, A.K. 2003. Methodology to establish seed production area for improved seeds in Pinus kesiya. Indian Forester, 129(3): 357-363.
Luna, R.K., Kumar, A. and Malik, A. 2007. Genetic improvement through establishment of seed production area in Punjab for Acacia catechu (Willd.). Indian Forester, 133(2): 178-183.
Zobel, B.J. 1993. Clonal forestry in Eucalyptus. In: Ahuja, M.R and Libby, W.J. Ed. Clonal forestry II: Conservation and application. New York, Springer-Verlag. pp.139-148.
Zobel, B. J. and Talbert, J. 1984. Applied forest tree improvement. Wiley, New York.
ENVIRONMENTAL
UPS
and DOWNS
Environmental Ups
British billionaire Richard Branson,
with former US vice-president Al Gore at his side, offered a $25 million prize for anyone who can come up with a way to blunt global climate change by removing at least a billion tons of carbon dioxide a year from the Earth’s atmosphere.

To contain the problem of global warming, the Ministry of Science and Technology, Govt. of India has proposed to setup a high-end research institute to look for alternative technologies.

Rajasthan government has decided to promote the cultivation and processing of Jatropha curcas by allotting nearly 57-lakh hectare wasteland at subsidized rates or free to private companies and groups.

Jammu and Kashmir government has decided to involve school children in preservation of chinar tree in Kashmir valley as the species is fast becoming endangered.

Malaysia, Indonesia and Brunei have entered into a historic agreement to conserve a 22 million hectare forest area in Borneo.

Delhi’s artificial wetlands developed at Yamuna Biodiversity Park have attracted more migratory birds than natural wetlands like Bhalaswa or Sanjay lakes.

Andhra Pradesh government has planned captive breeding of Great Indian Bustard, which was almost hunted to extinction, to help the bird bounce back from the brink.

The rare vulture species, including the white-backed, that had been declared ‘endangered’ have been spotted in flocks of dozens on the Punjab-Himachal border, along the Shivalik range.

Conservationists from India and Japan have teamed-up to analyse and chalk out a strategy to conserve the Ganges river dolphin, an endangered mammal.

The mortality rate of Irrawaddy dolphins in Chilka lake, the largest brackish lagoon in Asia, has drastically come down. Thanks to the conservation measures and conscious drive initiated by the Chilka Development Authority.

Chinese zoologists have artificially inseminated a four-year old Siberian tigress for the first time with a view to save the rare species from extinction.

To deter organised gangs of poachers from hunting down the tigers in Dudhwa National Park and other wildlife sanctuaries in Uttar Pradesh, the State Forest Department is strengthening its intelligence network by involving the local population.

In a bid to mobilise additional resources for conservation of the Asiatic lion and its associate flora and fauna in the Gir National Park and adjoining areas, the state government has decided to setup separate autonomous body called ‘Gujarat Lion Conservation Society’.

The Ministry of Environment and Forests, Govt. of India has proposed to setup ‘Green Courts’ to deal with environmental disputes.

The Govt. of India has decided to provide subsidy for farmers to encourage them to dug wells to trap rain water and recharge fast depleting groundwater.

The Govt. of India has constituted a task force to formulate a comprehensive strategy for protecting the environment.

A study by the scientists of the Netherlands and the United States of America has concluded that the reduction in production and use of ozone-depleting substances as mandated by the Montreal Protocol is having a significant collateral benefit – it has slowed down global warming by several years.

Worried over the fast shrinking ozone layer, countries in the Pacific region have agreed to phase out critical uses of CFC and other ozone depleting substances by 2008, two years ahead of their committed deadline.

Authorities of Corbett National Park have informed that they removed Lantana from 1,000 hectares of the park area by adopting a weed control method developed by the Centre for Environmental Management of Delhi University. In this method, the weed is cut below the coppicing zones.

The Forest Survey of India has revealed that the Delhi city’s forest cover has gone up by 15 per cent in two years: 283 sq. km. in 2005 to 326 sq. km. this year.

The large-billed reed warbler-a wetland bird that eluded scientists for more than a century, has now been sighted twice in the past year near Bangkok by an Asstt. Professor of Mahidol University.

The Jammu and Kashmir State Wildlife Department is planning to use Global Positioning System (GPS) to step up efforts for the conservation of Kashmiri Hangul. GPS radio collars will be fitted on the endangered deer species to help officials keep track of the movements.

Bogged down by the increasing number of elephants and growing incidents of man animal conflicts, the Bodoland Territorial Council has come up with a unique idea of setting up an orphanage for stray baby elephants in Western Assam.

Wildlife Institute of India experts have found that tigers are doing very well in the Corbett Tiger Reserve in Uttarakhand.

The Indian Council of Forestry Research and Education, Dehradun would establish model forestry demonstration village in Himachal Pradesh for demonstration and dissemination of latest information on forestry to people.

Union Ministry of Environment and Forests is conducting research to genetically modify bamboo for protecting bamboo cultivation from gregarious flowering in the country.

The World Bank has agreed in principle to extend the facility of carbon credit financing to encourage people to raise forests on private and community land under the Mid-Himalayan Watershed Development Project.

In an effort to ameliorate the effects of global warming, several groups are working on ventures to grow vast floating fields of plankton intended to absorb carbon dioxide from the atmosphere and carry it to the depths of ocean.

A group of 50 tribal women of Kochbahal village in Orissa has formed ‘Van Suraksha Samiti’ for the protection of local forest. The women armed with lathis and other traditional weapons roam around the forest in groups every day and confront the wood mafia with courage.
Environmental Downs
 According to Intergovernmental Panel on Climate Change, rising temperatures will leave millions more hungry by 2080 and cause critical water shortage in China and Australia, as well as parts of Europe and the United States.
 U.K. Meterological Office predicts that 2007 will be the warmest year on record.
 A ccording to Simon Delay, a water bird conservation officer, for Netherlands based Wetlands International, nearly half of the world’s water bird species are in decline, mostly due to rapid economic development and the effects of climate change.
 The Australian Prime Minister maintained his stand to not sign the Kyoto Protocol as it excludes world’s major polluters.
 Since 2001, Rajasthan has lost almost 1,000 peacocks-the National Bird of India, which is a protected animal under Wildlife Protection Act, 1972.
 As the enforcement agencies have frighten in on those trading in tigers, elephants and rhinos, the poachers are finding other victims-mongoose, musk deer, turtles, snakes and birds.
 According to the Fourth Assessment Report of the IPCC, ‘Climate Change 2007: Impact, Adaptation and Vulnerability’, global warming is expected to decrease substantially the cereal production potential in Asia, particularly in India.
 According to the report of London-based Royal Commission on Environmental Pollution, air pollution is responsible for 24,000 premature deaths in Britain every year.
 Gujarat Forest Department blames special economic zones, as well as haphazard and accelerated industrial development for the disappearance of mangroves.
 India’s exponentially increasing palm oil consumption is putting pressure on the forests of Indonesia and Malaysia and could add to the loss of biodiversity in the remaining rain forests of South-East Asia.
 The State Forests and Environment Minister of Assam informed the State Assembly that the poachers killed 37 one-horned rhinos in the Kaziranga National Park during the past five years.
 A billion people-one in seven people on Earth today-could be forced to leave their homes over the next 50 years, predicts Christian Aid.
 Researchers from the National Institute for Space Research of Brazil have estimated that large dams in India emit around 335 million tonnes of methane per annum, hence, are responsible for about a fifth of country’s total global warming impact.
 Human activities are wiping out three animals or plant species every hour, says UN Secretary General Ban Ki-Moon.
 Even after spending Rs. 1,500 crore on cleaning Yamuna, it has turned dirtier. Delhi and Agra accounts for 90 per cent of pollution in the river, says Centre for Science and Environment.
 According to an analysis of air quality of Delhi, carried out by the Centre for Science and Environment, ground level of ozone, which is extremely hazardous for human health, has begun to raise its ugly head.
MOLECULAR APPROACH TO GENETIC IMPROVEMENT OF FOREST TREES
S. A. Ansari and C. Narayanan
Tropical Forest Research Institute, Jabalpur 482 021
W
ropical forests are cradle of human civilization and fountainhead
of biodiversity. Post-industrial era has, however, witnessed rapid
destruction of the forests for a variety of reasons and purposes.
In addition, the urbanization and industrialization have created several problems such as global
warming, climate change and loss of habitat not only for wildlife but also for tribals and villa
gers, which can be addressed by only enhancing area and productivity of the forests.
Today, the forests are being looked for sustainability and productivity rather than their exploitation.
India is no exception to this. The total forest cover, i.e. 19.3 per cent is far below the
national requirement of 33 per cent forest cover. Further, it is estimated that the demand
for timber is likely to grow from 58 million cubic met. in 2005 to 153 million cubic meters
in 2020. The supply of wood is projected to increase from 29 million cubic met. in 2000 to 60
million cubic meters in 2020. The productivity of timber in India is only 0.7 cu. m/ha/year where
as the world average is 2.1 cu.m/ha/year. To achieve the lofty objective, the knowledge of geneti
cs and allied disciplines are expected to play a decisive role. Recently, advances in molecular
biology have complemented classical genetics in several ways. The present article intends to discuss aspects of genetic improvement of forest trees in the country and to endeavour for development of a strategy integrating these disciplines.
Genetic Improvement Scenario of Forests
Forest tree improvement programme commenced in the country way back in 1960s, incorporating trees of timber value (Dalbergia spp., Gmelina arborea, Tectona grandis), paper and pulp wood (Casuariana equisitifolia, Eucalyptus spp., Populus deltoides). Subsequently, some trees of fodder and fuel wood (Albizia spp., Acacia spp.) and medicinal values and biofuels (Azadirachta indica, Jatropha curcas, Pongamia pinnata) as well as
bamboos were also included. By and large, the erstwhile FRI and Colleges and later Indian Council of Forestry Research and Education, Derhadun, acted as nodal agency to implement various international programme, e.g. DANIDA Seed Project and World Bank FREE Project aimed at forest tree improvement.
Considering long production cycle of forest trees, the strategy hinged upon the principles of quantitative genetics and clonal propagation for both short and long-term goals so that the early benefits may be harnessed without losing broader prospects. In fact, there exists continuous variability for different traits, including those of economic importance in the population, which may arise due to genomic information inherited from the parents and its interaction with the prevalent environment. The former is stable and selective in subsequent generations, whereas the latter is not so. However, heritable variation may be detected on the basis of differential performance of populations and individuals in a similar environment, which is enacted as establishment of provenance or progeny trials at multi-locations. Similarly, some of the above average performers in the population may have superior genetic stuff and are selected as candidate plus trees or plus trees, some of which are later converted as elite trees on the basis of progeny test. Besides, the siblings of healthy and excellent performer are expected to inherit good traits, which gave way to the concept of seed production area, wherein superior individuals of the population are retained to allow cross fertilization and to produce improved seeds. As opposed to sexual reproduction perpetuating variation, the asexual reproduction or vegetative propagation retains genetic architecture intact and produces multiple copies, i.e.
clones of the same genotype. This helps capture natural genetic recombinants for superior performance of traits of economic importance. The plus trees or elite trees are cloned for establishment of clonal seed orchards or used as parents for obtaining superior genotypes with desired growth performance. The genetic improvement of forest trees is achieved only when these components are
operated in a tandem.
The tree improvement programme in the country could not proceed systematically but attained various levels for different species. Teak improvement programme made more progress than that on other species, which included selection of plus trees, establishment of provenance/progeny trials and clonal seed orchards, creation of seed production areas and also standardized macro- and micro- procedures for cloning. But there is also paucity in evaluation of progeny trials for conversion of plus trees into elite trees to carry tree improvement forward. As a result, the control cross and hybridization remained a distant dream for development of superior high productive varieties of teak. The genetic improvement programme on chir pines and eucalypts has also been noteworthy. Forest Research Institute, Dehradun has developed FRI 4 inter specific hybrid, whereas ITC, Bhadrachalam in collaboration with IFGTB, Coimbatore has screened and cloned superior performer of eucalypts. Similarly, WIMCO, Rudrapur has done remarkable work on Populus deltoides, which mostly deals with identification of superior segregants from progenies and their clonal propagation. The company has been very successful in introduction of Populus deltoides as a tree component in agro-forestry systems of North Indian plains.The next in line is casuarinas on which IFGTB, Coimbatore has made noteworthy progress. As for bamboos and some species of non wood forest produce, the sporadic genetic improvement work attaining the first level, i.e. field selection of superior phenotypes and establishment of provenance trial (e.g., Azadirachta indica) has merely been achieved. Similarly, propagation procedures completely disoriented with the mainstream of tree improvement have been developed for several forest species and find very little field application due to non-availability of genetically superior stuff of forest species for cloning. The reason for shortfall and disorientation is lack of patience and coordination between scientific thinking and field translation of the programme. Nontheless, tree programme has helped in identification and establishment of germplasm bank, segregating populations which could be effectively utilized for building up advanced level strategy incorporating recent advances in molecular biology for quick genetic gains in limited space and time.
Issues at Stake
Before proceeding further, it is required to identify various issues to be resolved through molecular biology. Unlike agricultural crops, forest trees are encouraged on wastelands of various kinds, which display deficiency or toxicity of nutrients and water in addition to other natural exigencies. This necessitates identification of site specific populations /genotypes. The other aspect relates to selection of populations /genotypes exhibiting high performance for traits of economic important such as wood quality, productivity, low lignin content, biofuel yield and active ingredient of medicinal plants. Selection of suitable parents for control breeding for trait improvement is also desirable. Demarcation and identification of populations, individuals and races, which elude morphometric descriptors linked with geographical locations also comprises an important component of genetic improvement programme and preparation of database for enumeration of total sum biodiversity of the country for future reference and use.
Molecular Genetics Assisted Forest Improvement
The classical tree improvement may deal with these issues effectively on a long-term basis. However, recent advances made in molecular biology are capable of assisting genetic improvement of forest species in a short span of time. Selection of trees with superior traits of economically importance for plantation and breeding programs is a lengthy and expensive process for tree breeders when selection is based on physical traits. In such situations, marker aided selection has great potential
in providing rapid and effective selection several years earlier in the growth cycle of forest trees (Fig. 1). In forest trees, molecular marker based research has great potential in improving traits, viz., tolerance to biotic and abiotic stress, qualitative and quantitative improvement in wood quality traits, etc.
Conventional selection and breeding for specific traits in forest trees involve long-term programme, needing consistent research of two to three decades. Briefly, selection for a specific trait is made from natural populations or plantations. Progeny trials are laid out under a range of environmental conditions. Expression of traits is assessed after several years when the traits are expressed. In some forest trees, this involves ten to fifteen years. In contrast, molecular markers considerably reduces different cycles of selection and breeding. Molecular marker analysis of genetic diversity and construction of high density linkage maps of forest tree species help in early selection of trees with economically important traits like wood density, tolerance to biotic and abiotic factors. for incorporation in further breeding programme for these traits.
Absence of full-sib progenies is the greatest limitation in linkage mapping of important traits in forest trees in the country. In such case, linkage disequilibrium (LD) or ‘association mapping’ of candidate genes is the most promising approach for identifying genes from natural populations (Ardlie et al., 2002). In contrast to the conventional quantitative trait locus (QTL) mapping, LD mapping is based on associations between genotype and phenotype variation in unorganized natural populations. While QTL mapping relies solely on recombination in progenies, LD mapping is based on phenotypic and genetic variation existing among individuals across a natural population which in turn is based on the past recombination events (Nordborg and Tavare, 2002; Borevitz and Nordborg, 2003). Among crops, LD mapping has been successfully done in maize (Thornsberry et al., 2001; Wilson et al., 2004), wheat
(Breseghello and Sorrells, 2005) and Arabidopsis (Olsen et al., 2004) for identification of genes involved in natural phenotypic variation. In forest tree species, “association mapping” has been done for candidate genes of phenyl-propanoid pathway controlling microfibril angle (MFA) in Eucalyptus spp., using individuals from a natural population of E. nitens. Association of allelic variant of genes was successfully determined and further confirmed in full-sibs of E. globulus and. E. nitens (Thumma et al., 2005).
Another technique called pseudo-testcross strategy also has potential in Indian forestry. Using this method, genomic maps have been constructed for loblolly pine (Grattapaglia et al., 1992), white spruce (Tulsieram et al., 1992), slash pine (Nelson et al., 1993), Norway spruce (Binelli and Bucci, 1994), Douglas fir (Broome and Carlson, 1994), Eucalyptus (Grattapaglia and Sederoff, 1994), maritime pine (Plomion et al., 1995) and Scots pine (Yazdani et al., 1995). Using a method called bulk segregant analysis, RAPD markers linked to genes of interest have also been identified (Michelmore et al., 1991; Grattapaglia et al., 1992; Devey et al. 1995; Lehner et al., 1995; Wilcox, 1995). Similar strategies can be followed for developing molecular maps in teak, sal and other important forest trees where full-sib progenies have not been established.
In Indian forest scenario, the most important traits for improvement relate to environmental stresses, wood quality and productivity. Extremes of soil conditions (e.g., salinity and water stress), temperature extremes and environmental pollution are the most important constraints influencing establishment and development of genetically improved trees. Research is being carried out to understand gene expression and physiological responses to biotic and abiotic stresses using conventional and molecular markers. Genes encoding for enzymes such as superoxide dismutase and osmoregulation genes are good candidates for conferring tolerance to pollutants and drought/salt stress, respectively. In loblolly pine, research has been done to improve tree growth response to drought stress. Similar studies can be carried out to improve stress tolerance in other trees also.
Improvement of wood quality through modification of lignin structure, composition and content has been investigated in forest trees. One of the strategies is to isolate and clone genes encoding for enzymes in lignin biosynthesis in trees. Similar studies can be done in teak and sal, which are very important timber-yielding tree species.
Modification of plant architecture such as dwarf and upright forms are priorities for trees used in various agroforestry systems. Research has been done on these lines in horticultural crops and can be extended to agro-forestry tree species where the form of trees is the limiting factor for crop productivity. Such studies can be done in potential agroforestry species like teak, sal, casuarinas, etc.
Genetic transformation using specific genes have been successfully carried out in larch and poplar. Larix decidua has been successfully transformed for expression of two agronomically important genes viz., aroAgene (herbicide tolerance) and Bt gene (insect resistance). Several studies have been done subsequently in other temperate and some broad leaf trees. The strategy can be extended to control insect pests of leaf skeletonizer and defolatior in teak and borer in sal, which incur huge loss of productivity in both species.
Considering these advantages in view, two days National Conference on Indian Scenario of Tree Biotechnology sponsored by CSIR and DBT, New Delhi and ICFRE, Dehradun was organized on February 10-11, 2007 at Genetics and Plant Propagation Division, TFRI, Jabalpur to chalk out a strategy for use of molecular genetics and allied disciplines for improvement of forest productivity. Some of the recommendations are enlisted here for the benefits of researchers working with forest systems:
1. Development of molecular markers and assessment of genetic variability in economically important and critically endangered species for utilization and conservation.
2. Identification of molecular markers linked to important traits in selected species of national importance for use in molecular breeding.
3. To develop genome sequencing initiatives coupled with functional genomics in selected species to identify candidate genes for use in tree improvement.
4. Development of genetic transformation protocols using marker or reporter genes in identified species for potential use in developing trasngenic lines.
5. Development of micropropogation protocols for the commercial production of elite lines in important species e.g. teak, Gmelina aroborea, Dalbergia spp., sandal, bamboo, etc.
6. Up-scaling of existing tissue culture tech-nologies for the commerical utilization.
7. Development of biotechnological initiatives for addressing resistance to abiotic and biotic stress for developing insect pest and disease resistant material in economically important species.
8. Establishment of National Bureau of Forest Genetic Resources, and National Institute of Forest Genome Research for guidelines, coordination and monitoring of endeavour for forest tree improvement programme.
Fig. 1. Comparison of some components of genetic improvement of forest trees using two different systems
It is hoped that above recommendations will strengthen genetic improvement of Indian forests, which will mitigate ill impact of global warming, elevate forest productivity and improve traits of economic importance.
Conclusion
The above discussion highlights the potential use of
techniques of molecular genetics for rapid improvement of forest species, for which a comparison
is presented in two flow diagrams (Fig. 1). Clearly, recent advances in molecular genetics may
help curtail duration of classical tree improvement programme by about 30-40 per cent and may
also confer additional advantages of quick genetic transformations incorporating genes of
economic interests from other organisms, for which requisite molecular details have been worked
out. At the moment, a colossal database of molecular genetics exists in the public domain, which
may be effectively utilized for construction of probes for identification of gene(s)/ QTLs in
desired genotypes/ populations of forest species and expression/suppression of
desired/undesired DNA segments in forest genome.
Reference
Ardlie, K.G., Kruglyar, L. and Seielstad, M. 2002. Patterns of linkage disequilibrium in the human genome. Nature Reviews Genetics,3: 299 – 309.
Binelli, G. and Bucci, G. 1994. A genetic linkage map of Picea abies Karts., based on RAPD markers, as a tool in population genetics. Theoretical and Applied Genetics, 88: 283-288.
Borevitz, J.O. and Nordborg, M. 2003. The impact of genomics on the study of natural variation in Arabidopsis. Plant Physiology, 132: 718 -725.
Bressghello, F. and Sorrells, M.E. 2005. Association mapping of kernel size and milling quality in wheat (Triticum aestivum L.) cultivars. Genetics, 172: 1165-1177.
Broome, E.J. and Carlson, J.E. 1994. Single genetic linkage map for Douglas-fir. In: The International Conference on the Plant Genome II, San Diego, 24-27 January 1994. poster 22.
Devey M.E.; Delfino-Mix, A.; Kinloch, B.B. and Neale, D.B. 1995. Random amplified polymorphic DNA markers tightly linked to a gene for resistance to white pine blister rust in sugar pine. Proceedings of the National Academy of Sciences, 92: 2066-2070.
Grattapaglia, D. and Sederoff, R. 1994. Genetic linkage maps of Eucalyptus grandis and E. urophylla using a pseudo-testcross mapping strategy and RAPD markers. Genetics, 137: 1121-1137.
Grattapaglia, D.; Wilcox, P.; Chaparro, J.; O’Malley, D.; McCord, S.; Whetten, R.; McIntyre, L.; Sederoff, R.; Weir, B.; Doerge, R. and Bridgewater, F.1992. Genetic map of loblolly pine. In: 6th Meeting of the International Conifer Biotechnology Working Group, Raleigh, NC.
Lehner, A.; Campbell, M.A.; Wheeler, N.C.; Pöykkö, T.; Glössl, J.; Kreike, J. and Neale, D.B. 1995. Identification of a RAPD marker linked to the pendula gene in Norway spruce (Picea abies (L.) Karst. f. pendula). Theoretical and Applied Genetics, 91: 1092-1094.
Michelmore, R.; Paran, I. and Kesseli, R.V. 1991. Identification of marker linked to disease resistance gene by bulk segregant analysis: A rapid mathod to detect markers in specific genomic regions using segregating populations. Proceedings of the National Academy of Sciences, 88: 9828-9832.
Nelson, C.D.; Nance, W.L. and Doudrick, R.L. 1993. A partial genetic linkage map of slash pine (Pinus elliotti Englem var. elliottii) based on random amplified polymorphic DNA’s. Theoretical and Applied Genetics, 8: 145-151.
Nordborg, M. and Tavare, S. 2002. Linkage disequilibrium: what history has to tell us. Trends in Genetics,. 18: 83 – 90.
Plomion, C.; O’Malley, D.M. and Durel, C.E. 1995. Genomic analysis in maritime pine (Pinus pinaster). Comparison of two RAPD maps using selfed and open-pollinated seeds of the same individual. Theoretical and Applied Genetics, 90: 1028-1034.
Olsen, K.M., Halldorsdottir, S.S., Stinchcombe, J.R., Weinig, C., Schmitt, J. and Purugganan, M.D. 2004. Linkage disequilibrium mapping of Arabidopsis CRY2 flowering time alleles. Genetics, 167: 1361-1369.
Thornsberry, J.M.; Goodman, M.M.; Doebley, J.; Kresovich, S. and Nielsen, D. 2001. Dwarf8 polymorphisms associate with variation in flowering time. Nature Genetics, 28: 286 – 289.
Thumma, B.R.; Nolan, M.F.; Evand, R. and Moran, G.F. 2005. Polymorphism in Cinnamoyl COA Reductase (CCR) are associated with variation in microfibril angle in Eucalyptus spp. Genetics, 171: 1257-1265.
Tulsieram, L.K.; Glaubitz, J.C.; Kiss, G. and Carlson, J.E. 1992. Single tree genetic linkage analysis in conifers using haploid DNA from megagametophytes. Biotechnology, 10: 686-690.
Wilcox, P.L. 1995. Genetic dissection of fusiform rust resistance in loblolly pine. Ph D thesis, North Carolina State University, 125p.
Wilson, L.M.; Whitt, S.R.; Ibanez, A.M.; Rocheford, T.R.; Goodman, M.M. and Buckler, E.S. 2004. Dissection of maize kernel composition and starch production by candidate gene association. The Plant Cell, 16: 2719 – 2733.
Yazdani, R.; Yeh, F. and Rimsha, J. 1995. Genomic mapping of Pinus sylvestris (L.) using random amplified polymorphic DNA markers. Forest Genetics, 2: 109-116
BIOTECHNOLOGICAL TOOLS IN FOREST TREE IMPROVEMENT
H.V. Srinidhi and Sanjeev K. Chauhan
Punjab Agricultural University, Ludhiana – 141 004
T
he scenario of forestry in developing countries is the progressive
reduction in the area of forests due to changes in land use and
over exploitation. While forests are being lost, there is growing demand both for
environmental services and wood and wood products. According to a forecast by FAO the wood
demand is expected to increase by 25 per cent from 1996 to 2010. In near future, the demand
for more biomass from trees will sequester more of the carbon dioxide from atmosphere.
As the areas under forest are not expanding, the huge demands have to be met with increased
productivity of the plantation forestry. The superior planting stock is the backbone of
successful high-output intensive forestry. They are economically attractive due to increased
yields and short rotation. Tailoring trees with desirable traits to fetch better yield can be
achieved through better tree improvement programmes.
Tree improvement is a continual process of selection,
testing, and breeding to increase the extent to which each generation of improved stock exhibits
desirable traits. Besides, it aims at the sustainable management of genetic variation to
produce, identify and multiply for the operational planting of well-adapted genotypes of the
desired quality. Breeding and selection are core activities of tree improvement programme.
Tree improvement programs were started in different parts of the world in early 1970. Since
then, progress has been documented in numerous aspects of forest tree productivity ranging from
growth and form improvements to increased tolerance to diseases (Zobel and Talbert, 1984; Sedjo,
1999). Despite this progress, there are a number of constraints in tree improvement processes.
Biotechnology is a collection of techniques that can be
used to enhance the impact of biological programme (Cheliak and Rogers, 1990). The application
of biotechnology in forestry can be grouped into three main areas: tissue culture techniques,
use of genetic markers and production of transgenic trees. Integration of these technologies in
tree improvement and the way in which each of these technologies can address the problem/enhance
the impact of conventional tree improvement are presented here.
Cell and Tissue Culture
To date, the major emphasis in forest biotechnology has
been on tissue culture. Strategies supporting large scale utilization of superior genetic materi
al need rational integration in tree improvement. Tissue culture broadly refers to techniques of growing plant tissue or parts in nutrient medium under aseptic condition. It involves a set of technique known as micro-propagation- a kind of clonal or vegetative propagation that can produce multiple copies of an elite genotype. It is a means to introduce novel genes as well. Mean to achieve this include Organogenesis and Somatic embryogenesis. In Organogenesis, organ primordial such as buds are initiated on explants with the aid of exogenously applied hormones. From these buds, shoots and roots are induced. Somatic embryogenesis is a method that starts with somatic cell(s) of donor plants and forms new embryo. Micro propagation is now being taken up as large commercial venture involving hundreds of laboratories around the world. Successful protocol now exists for more than hundred forest tree species, hardwoods and softwood (Bajaj, 1986; Mascarhenas and Muralidharan, 1989). Compared to vegetative propagation through cuttings, the higher multiplication rates possible through micro-propagation offer a
quicker capture of genetic gains in clonal forestry.
One of the major factors limiting early application of this technique in many large-scale
plantation programmes is that breeding and selection of desired clones are not sufficiently
advanced to take up clonal forestry (Haines, 1994). Current high costs and sophistications
could also be impediments to the direct use of micro-propagations for many species.
In Vitro Selection
In vitro selection refers to selection of
genotype based on test results using tissue culture under laboratory conditions. The traits
for which selection done includes, growth, resistance to stresses caused by agents such as salt,
heat, frost, drought, insects, metals and herbicides. Selection can be at the level of cells,
pollens, buds, shoots, embryo or whole plant. Screening is done by subjecting cell cultures to
causal agent directly (as in high and low temperature, herbicides, etc.) or its analogue toxins
are incorporated in growth medium. Useful correlations between in-vitro studies and
expression of desirable traits ex vitro, for disease resistance are being reported
(Frampton et al., 1983). One particular interesting example has been the selection of
Eucalyptus gunnii pollen surviving exposure to cold, which was capable of germination
and could be used in control pollination (Boudet and Marien, 1988). For major important traits in trees (in particular, vigor, stem form and wood quality) poor correlation with field response will limit the usefulness of in vitro selection. However, in vitro selection may be of possible interest in forestry for screening disease resistance and tolerance to abiotic stress.
Somaclonal Variation
The term ‘Soma-clonal variation’ has been used to
refer to variation, which has been observed in plants regenerated from cell or tissue culture,
but in general not from auxiliary bud or shoot tip culture. Variation arises due to
pre-existing inter-cellular variations or induced variation during culture (in most cases).
This technique would be of interest where insufficient variation is available to provide the
level sought for traits or existing variation is not easily used in breeding. For example,
herbicide tolerance is not known to exist in angiosperms which would be difficult to achieve
through traditional breeding (Mitchler and Hassig, 1988). This technology has limited
application in short or intermediate term improvement programme.
Protoplast Fusion, In vitro Embryo Rescue and Haploid Culture
Protoplast fusion comprises removal of cell wall and then fusion of cell contents. The hybrids developed are called somatic hybrids. Protoplast fusion could be important in genetic improvement for which wild relatives constitute extensive and untapped disease resistance gene sources (Haines, 1994). Nucleo-cytoplasmic incompatibility and poor plant regeneration from protoplast limits its application.
In vitro embryo rescue is usually used in fruit trees, to grow embryo that normally would abort due to incompatibility between ovule and embryo development. Mainly used in making crosses across the genera or species. Some early success include Pinus lambertiana X P. armandii (Stone and Duffield, 1950), Populus simonii X P. pyramidallis (Ho, 1987). Its application in tree species is impeded by difficulties in development of protocol.
Haploids are plants with ‘n’ somatic number of chromosomes, developed from male or female gametophyte. Haploid cultures are employed for rapid production of homozygous lines, which are colchicine treated and chromosome doubled, to get true homozygous lines. Mainly useful in self-pollinated crops to get pure lines. Hardwood trees species for which pollen cultures have produced plants are Betula pendula and 13 species or interspecific hybrids of poplars (Cheliak and Rogers, 1990). Induction of haploid doesn’t have immediate application in forest tree species. May be found useful in basic genetic studies of heterosis.
Cryopreservation and In vitro Storage
This comprises the maintenance of cells, tissues or organs in cultures where growth is slowed (e.g. by the reduction of light, temperature or nutrients) or suspended (by immersion in liquid nitrogen). Many technical difficulties are involved, particularly in the subsequent regeneration of plants from the cultures limit its application. Regeneration from cryo-preserved tissues has been induced for more than 70 species,
including coconut, rubber, cocoa and coffee, and for several forest tree species. These results have led to hopes that the technologies may have a number of applications in tree improvement. In vitro storage and cryopreservation have little to offer with regard to forest trees except germplasm preservation of threatened tropical tree species. In the longer term, cryopreservation and in vitro storage may have some application as a backup conservation strategy.
Synthetic or Artificial Seeds
Artificial seeds consist of somatic embryos surrounded
by a protective coating. It is a potential method to combine the advantage of clonal propagation
with low cost and high-volume capabilities of seed propagation. Artificial seed contain
nutrients to provide energy required for germination and the hormones may be used as supplement.
Sodium or Potassium alginate is commonly used as gel for encapsulation. Liquid cultures with
automation make embryo culture system economically feasible. Application in forestry includes,
production of superior genotypes early where seed orchards takes 20-30 years for flowering.
Millions of somatic embryo can be produced all the year round. In Conifers-Loblolly pine and
Norway spruce are successfully tried but with no reports of field planting and establishment.
In India, Eucalyptus citriodora and Santalum album synthetic seeds gave four per cent
germination in soil (Bapat and Rao, 1989).
Molecular Markers
Reliable information on the distribution of genetic variation is a
prerequisite for sound selection, breeding and conservation programmes in forest trees. Genetic
variation of a species or population can be assessed by measuring morphological and
quantitative characters in the field or by assessing variation at molecular level
(DNA or protein) in the laboratory using a molecular marker. Compared to traditionally
measured features such as vigor, stem quality and various morphological aspects, molecular marker
s offer the advantages of being unaffected by the environment or the developmental stage of the p
lant while also being very numerous. These characteristics have led to a number of potential appl
ications in tree improvement. This technique have provided useful genetic information to tree imp
rovement and are still very important tools for studies of tree genetics and tree breeding progra
mmes (Strauss, 1992). Molecular markers are of two classes. One that is derived from direct analy
sis of polymorphism in DNA sequences called as Molecular Genetic Markers, while the other derived
from studies of chemical product (terpenes) or proteins of gene expression referred as Biochemi
cal Markers. Isozymes are commonly used biochemical markers as detectably different enzymes, whi
ch catalyze the same reaction (Hamrick et al., 1992). Allozymes are specifically applied to situation
where the different forms are the results of allelic polymorphism (Tanksley, 1983). In isozyme analysis, particular enzyme or protein is extracted
from plant tissue and different forms are separated by gel electrophoresis on basis of molecular
size, shape and electric charge. Allozymes are co-dominant markers that enable us to distinguish
a heterozygote from a homozygote at a locus (Wendel and Weeden, 1989).This technique is useful in assessing gene flow, mating system and genetic drift. However, the number of markers closely linked to important loci is small in number. Further, low resolution of conventional gel electrophoresis makes it difficult to detect subtle variation in allozymes. A difficulty in standardizing the protocol hinders its universal application.
With the advent of restriction enzymes and Polymerase Chain Reaction (PCR) the assessment of genetic variation directly at DNA level is possible. RFLPs (Restriction Fragment Length Polymorphism), RAPDs (Randomly Amplified Polymorphic DNAs) AFLP (Amplified Fragment Length Polymorphism) are simple mendalian molecular markers used to assess the polymorphism at gene loci. As these class of markers
are based on DNA sequences, offer advantages such as heritable through generations; availability of standard protocol; easily extractable from any plant part; required in small quantity (in nanograms); easy to store and handle. Microsatellites or Simple Sequence Repeats (SSR) are another class of markers that rely on highly variable repetitive DNA sequences composed of short (<6 base pairs) sequences repeated in tandem. These are usually co-dominant and very powerful (Strauss et al., 1992). Disadvantage of microsatellite is the necessary of prior identification of these regions from genomic library. Using it for a new species makes it time consuming and costly task. In recent years, single nucleotide polymorphisms (SNPs), i.e. single base changes in DNA sequence, have become an increasingly important class of molecular marker. The potential number of SNP markers is very high, meaning that it should be possible to find them in all parts of the genome, and micro-array procedures have been developed for automatically scoring hundreds of SNP loci simultaneously at a low cost per sample.
Applications of molecular markers in the tree improvement include-
a. Quantification of genetic diversity
The use of molecular markers for the determination of the extent of variation at the genetic level, within and between populations, is valued in guiding genetic conservation activities. These are aimed at maintaining genetic diversity with respect to traits of both known and unknown importance. And helps in the development of breeding populations for specific end uses with appropriate large genetic variation. In both the cases, the use of molecular markers would circumvent the obstacle to measure variation in terms of quantitative traits, where environmental effects pose difficulty in calculating genetic diversity parameters and requirement for several years before many traits can be measured. For forest trees species, isozymes have been widely used for assessment of among and within population
variation in Abies alba, Larix deciduas, Picea abies, Pinus sylvestris (Muller-strack et al., 1992), Picea glauca, Pinus resinosa (Hamrick et al., 1992) and many others. RAPD techniques have been widely used assessment of genetic diversity in mohagony, eucalypts, poplars, spruce (Lakshmikumaran et al., 2001). AFLPs were used to catalogue genetic variation in neem (Lakshmikumaran et al., 2001), eucalypt (Marques et al., 1998). It should be noted that studies on genetic diversity based on molecular markers must be interpreted with caution, due to frequently low correlations with patterns of variation for adaptive traits, which are of major importance in forestry.
b. Genotype verification and delineation
Molecular markers have been widely used for
identification of genotypes and applied in taxonomic studies, biological studies and
genetic fingerprinting. The use of molecular markers has revolutionized studies of mating
systems, pollen movement and seed dispersal. These studies are of considerable practical
significance to advanced tree improvement programmes, specifically in population sampling,
design and management of seed orchards, estimation of pollen contamination and development
of controlled pollination methods (Neale et al., 1992). Germplasm identification,
through ‘genetic fingerprinting’, has been used in advanced breeding programmes which
rely on controlled crosses or in which the correct identification of clones for large-scale
propagation programmes is essential. RAPDs have been used to delineate provenance variation
in Pinus lambertiana, P. ponderosa and breeding zones have been designated in Pinus
lambertiana, P.ponderosa and Psedotsuga menziesii (Westfall and Conkle, 1992).
In Eucalyptus,RAPD markers have been used in genetic analysis of individuals and populations including clone fingerprinting, outcrossing rate estimation and phylogenic relationship studies (Grattapaglia and Sederoff, 1994). In oak, the molecular differentiation between Quercus petraea and Q. robur
was evaluated with RAPD markers (Moreau et al., 1994). The results of such studies aids in population sampling, seed orchard design and management, controlled pollination method and clonal forestry programme. For example, the knowledge of gene movement permits, breeder to estimate minimum distance between candidate trees when sampling natural population. Yeh (1989) cited an estimate of 65 m for Picea glauca
based on isozyme studies. The assessment of pollen movement is also of major significance in management of seed orchards, in estimating pollen contamination, mating pattern among the clones, inbreeding, etc. Approaches to detection of contamination have been discussed in more detail by Wheeler and Jech (1992). Isozymes have been used to show that 30 per cent or more of Douglas fir and Loblolly pine controlled crosses were not correct (Adams et al., 1988). Molecular markers also used to assess extent of inbreeding and preferential mating systems in seed orchards. Selfing rates of 16 per cent were reported in a Pinus sylvestris orchard and also revealed that
only two of 33 clones contributed about 50 per cent of pollen in two consecutive years. Some times tree breeding programme encounters problems in identification of seed lot (provenance, orchard batch, family lot, etc.) or clone. Misidentifications of clones in seed orchard establishment or crossing are very common which could be overcome with the help of markers.
c. Gene mapping and marker-assisted selection (MAS)
Genetic linkage maps can be used to locate genes
affecting quantitative traits of economic importance. Quantitative traits, such as wood yield,
wood quality or pulp yield, are usually controlled by many genes, termed Quantitative Trait
Loci (QTL). By using molecular markers closely linked to, or located within, one or more QTL,
information at the DNA-level can be used for early selection. The potential benefits of MAS are
greatest for traits that are difficult, time-consuming
or expensive to measure (e.g., wood quality traits or pulp yield). Mapping and MAS tend to be
used only in species of high economic value and have most potential in clonal breeding programmes
. MAS refer to indirect selection on the basis of markers shown to be associated with
commercially important genes. Unaffected by the environment or developmental stages, markers
offer the possibility of highly effective and early selection, for e.g. selection for wood
quality at the young seedling stage (Nance and Nelson, 1989; Neale et al., 1992). Although the
possibilities are very attractive, there are limitations that will prohibit application in the
short or medium term. Marker analysis is currently too expensive to permit the screening of
large populations of seedlings. It could be appreciated in mainly advanced breeding programmes,
those for which the creation and maintenance of the appropriate pedigree record is affordable
and where clonal forestry is achievable. Linkage maps have been constructed in using RAPD
markers in Douglas-fir (Krutovskii et al., 1998). Highly variable SSR markers are also
available (Slavov et al., 2004). Traits of major importance in forestry are mainly quantitative
but work directed at identification of QTL’s in trees has not been
progressed so far except in Populus and in few conifers.Hindrances are large size of genome, scarcity of multigenerational pedigree and long generation (Tulseiram et al., 1992). QTL analyses are highly informative providing information on location of QTL affecting a trait, magnitude of each of QTL, gene action and parental sources of beneficial alleles. This would help in improving the efficiency of selection and detailed understanding of genetic architecture of complex traits. Mapping of QTLs for commercially important traits and adaptive traits in poplars (Bradshaw and Stettler, 1995), Douglas-fir (Wheeler et al., 2004) and Eucalyptus (Grattapagalia, 2004) have been reported. Poplar is the first tree to be genome sequence (Tuskan et al., 2006)
The major current value of molecular markers lies in long-term strategic research. Marker studies are making great contributions to advances in the understanding of basic genetic mechanisms and genome
organization at the molecular level. An important emphasis of this work in coming years will be the study of quantitative traits of forest trees, of which a few model species will receive most attention, for example loblolly pine (Pinus taeda), poplar (Populus spp.).
Genetic Engineering
This technique involves insertion of novel genes into a
plant or else the modification of existing genes through manipulation of the DNA molecule. This
is more popular in agricultural crops where genes for
insect, virus and selected herbicide resistance have been incorporated. Improvement of trees by
conventional breeding is constrained by their long reproductive cycle and complex reproductive characteristics.
Genetic engineering offers an attractive addition to conventional breeding because it permits
the transfer of valuable traits into selected genotypes without compromising their desirable
genetic background. Recombinant DNA technology has made an easy and an unlimited gene pool with
desirable traits for tree breeders. Endogenous gene already present in the tree genome can be
modified to improve certain traits, such as fiber quality and quantity, lignin reduction. The
genes coding for novel traits which were not available in the genome are inserted to confer
entirely new traits such as herbicide tolerance, insect resistance, abiotic stress tolerance,
etc. The traits transferred are expected to have a positive impact on economics of plantation
in terms of improved growth, reduced rotation, improved woodquality, reduced cost of pest
control or confer distinct environmental benefits during wood production or processing like
improved pulping, reduced inputs of hazardous chemicals and energy (Strauss et al., 1992).
The two most common transformation methods are
Agrobacterium mediated DNA transfer and bombardment with DNA coated micro-projectile
called as biolistic method. Between the two, biolistic method is popular because of
non-compatibility of Agrobacterium for most of the species. First report of genetic
transformation and recovery of transformedplants of a forest tree involved insertion of herbicide tolerance gene into hybrid poplar using Agrobacteruim tumefaciens (Fillati et al., 1987). Routine
transformation procedures are available for most of species such as poplar and their hybrids, Eucalyptus, Pinus, Picea, Larix (Llewellyn, 2000). Production of first transgenic conifer was reported a decade ago (Ellis et al., 1993).
Herbicide tolerance has been a major trait for transformation in both agricultural crops and trees as commercially attractive trait because it minimizes the herbicide use and thus cost of cultural operations. Higher and commercially relevant Glyphosate (a herbicide) tolerance in poplar was achieved by using the CP4 gene with a chloroplast transit peptidase sequence (Haines, 1994). Other species that were explored are Eucalyptus grandis (Llewellyn, 2000) and Larix decidua (Shin et al., 1994).
With respect to insect resistance, primarily it is focused on use of delta endo-toxin gene (cry) from soil bacteria Bacillus thuringensis (Bt). Poplar, walnut,
white spruce and European larch were tailored with cry genes (Haines, 1994). Under laboratory conditions, high levels of mortality have been reported for Lepidopteron pests on transgenic poplar (McCown et al., 1991). The large-scale multilocation field evaluation of lepidopteron resistant poplar took place in China, where 20,000 clones were planted at in 1995, but no results have been reported to date (van Frankenhuzen and Beardmore, 2004).
Another trait targeted is to confer disease resistance. Several economically important hardwood tree species are susceptible for crown gall disease. Because of high infective nature of disease, economic loss is considerable on various hardwood trees. Method of using antisense oncogenes from causal agent Agrobacterium itself revealed resistance against crown
gall in hybrid poplar. Genes coding for phytoelexin manosonone revealed to hold potential for future development of resistance in elm trees (Duchesne et al., 1985). Very few reports have been published so far in hardwood species.
Abiotic stress, a looming world wide problem of climate change, desertification, and salinization are challenges to foresters in near future. Transgenic forest trees are being developed to unveil the stress tolerance mechanism using loblolly pine (Pinus radiata) and
poplar as models. Salt tolerance in loblolly pine with genes transformed to regulate osmotic balance has been found successful. Cold-tolerant genes are likely to be of some commercial value for many species, in particular the eucalypts. Transgenic having potential to clean up the environmental pollutants especially heavy metals and organic pollutants have been targeted. Transgenic yellow poplar (Liriodendron tulipifera) with bacterial mercuric
reductase gene was reported to convert highly toxic mercury (Hg[II] to less toxic form Hg[0]) (Rugh et al., 1998). Similar approaches are being followed to remove range of organic pollutants such as TNT, RDX, tricholoethyele (Gordon et al., 1998). The advancement of molecular genetics is expected to provide inputs for engineering abiotic stress tolerance in trees, which is a complex phenomenon.
Modification of Wood Quality and Quantity
Lignin modification and reduction are target trait in
wood properties for many reasons. The removal of lignin is costly and energy consuming component
of pulp and paper production process. One way to improve efficiency of pulping is to
genetically reduce quantity or to alter quality of lignin in pulpwood species. Angiosperms
with Guaiacyl-syringyl lignin can be easily excluded at less expenditure of chemicals, energy
and time when compared to Guaiacyl lignin in conifers (Chiang and Fanooka, 1990). Moreover,
conifers are preferred for pulping due to their long and superior cellulose fibers. The changing
of Guaiacyl lignin in conifer to Guaiacyl-syringyl lignin types of angiosperm are being tried
(Bugus et al., 1991). The most outstanding achievement to date is 45 per cent reduction
in structurally normal lignin resulting from anti-sense
suppression. Lapieere et al. (1999) found that Cinnamyl alcohol dehydrogenase (CAD) activity increased the incorporation of aldehydes and free phenolic groups that facilitated lignin solubilisation during kraft pulping. CAD anti sense poplar was found to be amenable for easy delignification with higher pulp yields, thereby saving chemical (6 per cent) and increased pulp yield (2-3 per cent).
Prevention of the escape of genes into wild populations is likely to become an important concern, and inducing sterility an early target of genetic engineering work with forest tree species. The major factor limiting application of genetic engineering in forest trees is the lack of knowledge of molecular control of the traits such as growth, adaptation, stem and wood quality. Long rotation for tree limits extensive evaluation before release. Other concerns like effect on non-target insects, stability of expression up to desired level, etc. are also unpredictable.
Conclusion
Biotechnology has potential to enhance tree improvement
programme in number of ways. Tissue culture facilitates multiplication of selected genotype more
efficiently or more quickly and means of preserving germplasm. With aid of molecular markers,
we can gain more insight into nature, organization and control of genetic variation. Genetic
engineering allows creating new types of trees by introducing novel traits. Modern
biotechnology should be perceived as a new group of tools, means to be used as adjuncts,
or complements to conventional technologies in solving problems directed at meeting the needs
of human beings. A balance should be maintained between modern biotechnological and conventional
research. The development and application of biotechnology should be driven by needs and not by
technological capability. The relative costs (financial, social, political or environmental) of
the biotechnologies versus the relative benefits (productivity, food security or otherwise)
should be thought carefully before taking
up the task. The use of modern biotechnologies should be promoted for more efficient solutions to problems, which requires most urgent attention shortly.
References
Adams, W.T.; Neale, D.B.; Doerksen, A.H and Smith, D.B. 1988. Verifying control crosses in conifer tree improvement programs. Silvae Genetica, 37: 149-152.
Bajaj, Y.P.S.. 1986. Biotechnology of tree improvement for rapid propagation and biomass energy production. In: Bajaj, Y.P.S. Ed. Biotechnology in agriculture and forestry.Vol. 1: Trees. Berlin, Springer Verlag. pp. 1-23.
Bapat, V.A.; Rao, P.S.. 1989. In vitro strategies for sandalwood propagation.. In: International Workshop on Applications of Biotechnology in Forestry and Horticulture, New Delhi, 14-16 January 1988. Applications of biotechnology in forestry and horticulture: Proceedings edited by Vibha Dhawan. New York, Plenum Press. pp.145-156
Boudet, A. M and Marien, J.N. 1988. Strategy for breeding cold resistance in woody plants through pollen selection. In: Barbe, J.P and Bouqeut, A. Eds. Les strategies de selection face aux technologies modernes. Paris, Moet Hennessy Louis Vuitton. p.6.
Bradshaw, H.D. and Stettler, R.F. 1995. Molecular genetics of growth and development in Populus. IV. Mapping QTLs with large effects on growth, form and phenology traits in a forest tree. Genetics, 139: 963-973.
Bugus, R.C.; Chaiang, V.L.C. and Campbell, W.H. 1991. cDNA cloning, sequence analysis, seasonal expression of lignin bispecific caffeic acid in aspen. Plant Molecular Biology, 17:1203-1215.
Chaiang, W.M. and Fanooka, M. 1990. The dissolution and condensation of guaiacyl and syringyl units in residual lignin in kraft pulping. Holzforschung, 44:147-155.
Cheliak, W.M. and Rogers, D.L.1990. Integrating biotechnology in tree improvement. Canadian Journal of Forest Research, 20: 452-463.
Duchesne, L.C.; Jeng, R.S. and Hubbes, M. 1985. Accumulation of phytoleaxin in Ulmus americana in response to infection. Canadian Journal of Botany, 63: 678-680.
Ellis, D.D.; McCabe, D.E. and McInnis. 1993. Stable transformation of Picea glauca by particle gun method. Bioresource Technology, 11: 84-89.
Fillati, J.J.; Sellmer, J. and McCrown, B. 1987. Agro-bacterium mediated transformation and regeneration of poplar hybrid. Molecular and General Genetics, 206: 192-199.
Frampton, L.J.; Amerson, H.V. and Weir, R.J. 1983. Potentials of In vitro screening of loblolly pine for fusiform rust resistance. 17th Southern Tree Improvement Conference. Proceedings. pp.325-333.
Gordon, M.P.; Choe, N.; Duffy, J.; Ekun, G.; Heilman, P.; Muiznieks, I.; Ruszaj, M.; Shurtleff, S.; Strand, S.; Wilmoth, J and Newman, L.A. 1998. Phytoremediation of trichloroethylene with hybrid poplar. Environment in Health Perspectives, 106: 1001-1004.
Grattapaglia, D and Sederoff, R. 1994. Genetic linkage maps of Eucalyptus grandis and E. urophylla using a pseudo-testcross mapping strategy and RAPD markers. Genetics, 137: 1121-1137.
Haines, R. 1994. Biotechnology in forest tree improvement. Rome, FAO. 230 p.
Hamrick, J.L., Godt, M.J.W. and Boyles, S .1992. Factors influencing levels of genetic diversity in woody plants. New Forests, 6: 95-125.
Ho, R.H.1987. Embryo culture. In: Bonga, J.M. and Durzon, D.J. Eds. Cell and tissue culture in forestry. Vol. 2. Doeracht, Martinus Nijhoff.pp. 137-167.
Lakshmikumaran, M.; Srivastava, P.S. and Singh, A. 2001. Application of molecular marker technologies for genome analysis and assessment of genetic diversity in forest tree species. In: Shaanker, U.; Ganeshaiah, K.N. and Bawa, K.S. Eds. Forest genetic resources: Status, threats and conservation strategies. New Delhi, Oxford and IBH Publishers. pp. 153-181
Lapieere, C.; Pollet, B. and Pettit, C.M. 1999. Structural alterations of lignin in transgenic poplar with depressed CAD or CA activity in larix an opposite impact on efficiency of industrial kraft pulping. Plant Physiology, 119:153-163.
Leple, J.C.; Pillate, G and Jowain, L. 2000. Transgenic poplar trees. In: Bajaj, Y.P.S. Ed. Transgenic trees: Biotechnology in forestry. Vol 44. Berlin, Springer Verlag. pp.221-224.
Llewellyn, D. 2000. herbicide tolerant forest trees. In: Jain, S.M. and Minocha, S.C. Eds. Molecular biology of woody plants. Vol 2. Dordrecht, Kluwer Academic Press. pp. 439-466.
Marques, C.M.; Araujo, J.A.; Ferreira, J.G.; Whetten, R.; O’Malley; Liu, B.H. and Sederofff, R. 1998. AFLP genetic maps of Eucalyptus globulus and E. tereticornis. Theoritical and Applied Genetics, 96: 727-737.
Mascarhenas, A.F and Muralidharan, E.M. 1989. Tissue culture of Forest trees in India. Current Science, 58: 606-613.
McCrown, B., McCabe, D. and Russel, D. 1991. Stable transformation of poplar for rust resistance. Plant Cell Report, 9: 590-594.
Mitchler, C.H and Hassig, B.E. 1988. Increased herbicide tolerance of in vitro selected hybrid poplar. In: Ahuja, M.R. Ed. Somatic cell genetics of woody plants. Berlin, Spinger- Verlag. pp 183-189
Muller-Strack, G., Bardart, P. and Bergman, I. 1992. Genetic variation within European tree species.New Forests, 6: 23-47.
Moreau, F., Kleinschmit, J and Kremer, A. 1994. Molecular differentation between Quercus petraea and Q. robur assessed by random amplified DNA fragments. Forest Genetics, 1: 51-64
Neale, D. B., Devey, M.E. and Groorer, A.J .1992. Molecular markers and Quantitative mapping in Loblolly Pine. In: Proc. of VII Meeting of Intr. Con. Biotechnology working Group, Raleigh, NCSU.
Neale, D.B. and Williams, C.G. 1991. Restriction fragment length polymorphisms mapping in conifers and applications to forest genetics and tree improvement. Candian Journal of Forest Research, 21: 545-554.
Rugh, C.L., Senecoff, J.F.,Meagher, R.B. and Merkle, S.A. 1998. Development of transgenic yellow poplar for mercury phyto-remediation. Nature Biotechnolgy, 16: 925-928.
Sedjo, R.A. 2001. Biotechnology in forestry: considering the costs and benefits. Resources, 145: 10-12.
Shin, D.I., Podila, G.K and Karnosky, D.F.1994. Transgenic larch expressing genes for herbicide and insect resistence. Candian Journal of Forest Research, 24: 2059-2067.
Slavov, G.T., Howe, G.T., Yakovlev, I., Edwards, K.J., Krutovskii, K.V., Tuskan, G.A., Carlson, J.E., Strauss, S.H. and Adams, W.T. 2004. Highly variable SSR markers in Douglas-fir: Mendelian inheritance and map locations. Theoritical and Applied Genetics, 108: 873-80.
Stone, E and Duffield, J.1950. Hybrids of sugar pine by embryo culture, Journal of Forestry, 48: 200-201.
Strauss, S.H, Bosquet, J, Hipkins, V.D., and Hong, Y.P.1992. Biochemical and molecular genetic markers in biosystematics of forest trees. New Forests, 6: 125-158.
Strauss, S.; Boejan, W. and Cainey, J. 1992. GMOs: Forest Biotechnology makes its own position. Nature Biotechnology, 17: 1145-1149.
Tanksley, S.D. 1983. Molecular markers in plant breeding. Plant Molecular Biology Reporter, 1: 3-8.
Tulseiram, L.K.; Glaubitz, J.C.; Kiss, G. and Carlson, J.E. 1992. Single tree genetic linkage mapping in conifers using haploid DNA from mega gametophytes. Biotechnology, 10: 686-690.
Tuskan et al., 2006. The genome of black cottonwood, Populus trichocarpa. Science, 313:1596-1604.
van Frankenhuzen, K. and Beardmore, T. 2004. Current status and environmental impact of transgenic trees. Candian Journal of Forest Research, 34:1163-1180.
Wang, G., Castiglione, S., Chen, Y., et al., 1996. Poplar transformed with Bt. insecticidal activity and genomic analysis. Transgenic Research, 5: 289-301.
Weedon, N.F. 1989. Applications of Isozymes in plant breeding. Plant Breeding Review, 6: 11-54.
Wendel, J.F. and Weedon, N.F. 1989. Visualization and interpretation of plant isozymes. In: Soltis, D.E and Soltis, P.S. Eds. Isozymes in plant biology. London, Chapman and Hall.
Westfall, R.D and Conkle, M.J. 1992. Allozyme markers in breeding zonation designation. New Forests, 6: 279-309.
Wheeler, N.C. and Jech, K.S. 1992. Use of electrophoretic markers in seed orchard research. New Forests, 6: 311-328.
Wheeler, N.C.; Jermstad, K.D.; Krutovsky, K.; Aitken, S.N.; Howe, G.T.; Krakowski, J and Neale, D.B. 2004. Mapping of QTLs controlling adaptive traits in coastal Douglas-fir. IV. Cold hardiness QTL verification and candidate gene mapping. Molecular Breeding, 2: 1-12.
Whiteman, A. and Brown, C. 1999. The potential role of forest plantations in meeting future demands for industrial wood products. International Forestry Review, 1(3): 143-152.
Yeh, F.C.H.1989. Isozyme analysis for revealing population structure for use in breeding strategies. In: Conference on Breeding Tropical Trees: Population Structure and Genetic Improvement Strategies in Clonal and Seedling Forestry, Pattaya, 28 November-3 December 1988. Breeding tropical trees-population
structure and genetic improvement strategies in clonal and seedling forestry: Proceedings edited by G.L. Gibson, A.R. Griffin, A.C. Matheson. Oxford, Oxford Forestry Institute. pp.119-131.
Zobel, B.J and Talbert, J. 1984. Applied forest tree improvement. John Wiley. 505p
|
INTERNET RESOURCES
ON
FOREST GENETICS AND TREE IMPROVEMENT
REFORGEN Database: The FAO Worldwide Information System on Forest Genetic Resources
www.fao.org/forestry/site/fgr/en/
Provides information on activities related to the conservation, enhancement and utilization of forest genetic resources, by species in each country.
Institute of Forest Genetics: Davis Wiki
www.daviswiki.org/Institute_of_Forest_Genetics
The Institute of Forest Genetics is a US Forest Service research unit that focuses on three areas: biodiversity and conservation genetics, disease resistance and the molecular genetics and genomics of traits underlying the health and productivity of forests. Davis Wiki is a part of the Wiki Spot project, which provides a home and interconnectivity for all kinds of wiki projects.
Forest Genetics: Definition and Much More
www.answers.com/topic/forest-genetics
It describes variation and inheritance in forest trees, and provides knowledge necessary to breed trees through traditional methods of selection and hybridization and also through the newer biotechnologies.
Forest Genetics
www.metla.fi/info/vlib/forestgen/breeding.htm
It provides an ultimate collection of links for forest genetics and information about tree improvement, research activities, conservation of forest genetic resources, etc.
North-West Tree Improvement Cooperative (NWTIC)
www.fsl.orst.edu/nwtic/
The mission of NWTIC is to assist and coordinate members in developing and managing their forest gene resources in the Pacific North-West. The site provides information on the tree improvement and breeding strategies that have been developed for each species.
Forest Genetics and Tree Improvement
www.msucares.com/forestry/management/genetics.htm
Provides study of hereditary variation in different tree species.
PNWTIRC Tree Improvement
www.fsl.orst.edu/pnwtirc
The Pacific North-West Tree Improvement Research Cooperative (PNWTIRC) was formed in 1983. It conducts research in support of operational tree improvement in the Pacific North-West. The purpose of the Pacific North-West Tree Improvement Research Cooperative is to conduct genetics and breeding research on Pacific North-West tree species with the goal of providing priority information that will enhance the efficiency of tree improvement efforts.
|
V
i e w p o i n t
FOREST GENETICS AND TREE IMPROVEMENT: WHAT HAVE WE ACHIEVED?
C.J.S.K. Emmanuel
Arid Forest Research Institute, Jodhpur-342 005
Introduction
T
he beginning of tree improvement work in India is from 1930
when Prof. Champion realized the importance of
geographical variations and conducted a seed origin trial of pine. During the same period
Prof. Laurie established All-India Teak Seed Origin Trial. Silvicultural conferences since
1949 far sighted the need for tree improvement activities and continuously emphasized the
importance and need for widespread application of genetics and initiating research in this
field. In 1956, an expert committee at the Forest Research Institute, Dehradun recommended
the formation of Forest Genetics Section. Realizing the importance of this subject, Forest
Research Institute, Dehradun opened a Forest Genetics Section during 1959-60 attached to Botany
Branch under the then Directorate of Biological Research. In the year 1961,
Prof. J.D. Mathews, an expert from F.A.O., visited India to give guidelines for the proposed
work. He suggested initially to work on some priority species viz. Tectona grandis, Bombax
ceiba, Pinus spp., Dalbergia sissoo, Santalum album, Morus alba and Pterocarpus santalinus.
On the recommendations of the Expert Committee on Forest Research Institute, Genetics Section
was elevated to the status of a Branch in 1969–70, under the Directorate of Forestry Research.
The work got an impetus during the Fifth Plan period when two central sector schemes started
functioning. The first one in collaboration with DANIDA as ‘Indo-Danish Project on Seed
Procurement and Tree Improvement’ with its headquarters at Hyderabad and a centre at Dehradun,
Hyderabad and Coimbatore. The objective of the scheme was to provide assistance for seed
procurement of exotic species. This main task included the necessary testing of seed and source
material under a tree breeding program aiming at mass production of genetically improved seed.
The second scheme was‘Creation of Radio Isotope Laboratory Facility’. The
objective of the study was to work on physical and chemical mutagenesis of forestry species,
calculate the LD50 dose and screen out variants for future tree breeding work.
In 1988, reorganisation of Forest Research Institute
took place and a Division of Forest Genetics and Tree Propagation was formed by merging Forest
Genetics Branch, Indo-Danish Project on Seed Procurement and Tree Improvement Centre, Dehradun
and Radio Isotope Laboratory. After the formation of this division, seven projects have started
functioning under it for the improvement of some selected species viz. Acacia nilotica, A.
catechu, Albizia spp., Prosopis cineraria, Pinus roxburghii, P. wallichiana, Robinia
pseudoacacia and T. grandis. Under the umbrella of Indian Council of Forestry Research and
Education, ‘Institute of Forest Genetics and Tree Breeding’ started functioning at Coimbatore.
Besides this, three other institutes have genetics division and today all the ICFRE institutes
have full fledged tree improvement facilities. Number of agricultural universities have started
faculty of forestry and tree improvement became a part of it. In this review only work done at
ICFRE has been included.
Achievements Utilizing Natural Genetic Variability within the Species
1. Provenance Trials
Nature has provided vegetation to suit different type of climate, soils and environments. With the increasing pressure on land, it has become essential to choose particular provenance, which suits best to a particular environmental conditions to obtain higher yield per unit area (Venkatesh, 1974; Rawat et al., 1987). The species on which some work has been done are teak, bombax and eucalypt. In Eucalyptus camaldulensis,
it was observed that the latitude of the seed origin is correlated with some economic traits studied on twelve Australian provenances (Vakshasya, 1973 and 1988; Venkatesh and Vakshasya, 1979). In bombax, Assam provenance has
shown better performance than local ones at New Forest, Dehradun. There are trials going on for D. sissoo with 27 provenances distributed to 13 states (Vakshasya et al., 1988) and P. wallichiana with 30 provenances
distributed to four states (Thapliyal et al., 1985). An International Neem Network where 21 countries are participating established trial of 30 neem provenances in 17 participating countries during 1995. The assessment methodology was prepared for initial five years (Emmanuel, 1997). Emmanuel (2001) has reported that in the International Neem Network trial at Jodhpur, Annur (India) provenance is performing best followed by Ballarshah (India) and Kalyani (India). At Jaipur, Ghatti Subramaniyam (India) is performing best followed by Kalyani (India), Lamahi Dang (Nepal) and Sagar (India). In the 39 provenances studied for oil and azadirachtin content, Shivpuri (0.93 per cent) was found best for azadirachtin and North Bilaspur (49 per cent) for oil content (Emmanuel and Tomar, 2003). In 24 populations of neem in Tamil Nadu highest oil content was recorded in Nanjangud population (48.55 per cent) and highest azadirachtin content (10,006 ppm) in Kalangal population (Singh et al., 2007). Emmanuel (2003) has discussed the progress of the Gmelina arborea trials initiated by DANIDA and their present
condition. Provenance variations in cone and seed characters of Cedrus deodara have also been recorded (Mugal and Thapliyal, 2006).
2. Plus Tree Selection
Plus trees are the superior phenotypes selected from natural forests or plantations. This is the first step for starting any long term tree improvement programme to produce genetically superior seeds on mass scale. Based on the importance of commercial forest tree species and their end use selection criteria were prepared for candidate trees and their approval as plus trees (Mathew, 1961; Muniswamy, 1978; Bagchi, 1983; Rawat and Uniyal, 1986) for a number of species viz. teak, semul, shisam, chir, kail, deodar, fir, spruce, Prosopis, acacia,
etc. These guidelines were circulated to the
state forest departments for intensive survey and selection of candidate trees. These trees were later on screened for the selection of plus trees on comparison with check trees on the basis of growth, vigour, form, fruiting, resistance to insect/diseases, forest produce and other characters. In collaboration with state forest department, approximately 1,200 plus trees have been selected (Kedharnath, 1967 and 1982; Emmanuel and Bagchi,, 1988) for different species, prominent among them are T. grandis (714), B. ceiba (62), D. sissoo (53), G. arborea (60), P. roxburghii (186), S. album (30) and P. santalinus (258).
The reports given by Sharma et al. (2002) and Katwal et al. (2003) state that we have 971 plus trees of different species namely A. indica (87), D. sissoo (173), Casuarina equisitifolia (91), T. grandis (433), E. tereticornis (42), D. latifolia (15), Tecomella undulata (15), Acacia nilotica (4), Prosopis cineraria (6), A. tortilis (8) and P. roxburghii (97).
3. Seed Stand/Seed Production Area
It is the quickest method of producing genetically improved quality seeds to raise new plantations with increased productivity. To select seed stands of important forest tree species criteria were prepared (Mathew, 1961; Kedharnath and Mathew 1962; Muniswamy 1978; Rawat, 1983; Vakshasya and Rawat 1984; Nayal and Rawat, 1984) and circulated among the state forest departments. Approximately 15,000 ha have been selected (Thapliyal et al., 1988 and Emmanuel et al., 1990) for different species prominent among them are T. grandis 9358.862 ha, B. ceiba 67.9 ha, P. roxburghii 2934.2 ha and Eucalyptus sps. 99.44 ha.
The report given by (Sharma et al., 2002) and Katwal et al. (2003)
states that we have 1,225.6 ha of seed production areas of different species namely A. indica (87 ha), D. sissoo (173 ha), C. equisitifolia (91 ha), T. grandis (433 ha), E. tereticornis (42 ha), D. latifolia (15 ha), T. undulata (15 ha), A. nilotica (4 ha), P. cineraria (6 ha), A. tortilis (8 ha) and P. roxburghii (97 ha).
Survey conducted on seed requirements for different species have shown that in case of teak (Srimathi and Emmanuel, 1986) using seeds from seed production areas require 2.5 kg seeds to raise one hectare of plantation, where as from other sources 10 to 40 kg seeds per hectare was required. This shows that gains are obtained both genetic and economic when seed from s
4. Seed Orchards
To produce genetically superior seeds on mass scale, seed orchards are developed from the clonal material. State forest departments interested in this work were helped to establish seed orchards by providing necessary assistance for vegetative propagation techniques, planting designs, etc. (Venkatesh, 1981; Vakshasya and Rawat, 1985; Vakshasya et al., 1988). One pilot seed orchard for demonstration was established with 20 clones of teak at New forest, Dehradun (Kedharnath et al., 1970; Rawat et al., 1984; Uniyal and Rawat, 1997). Two seed orchards of B. ceiba were established in Uttar Pradesh (Venkatesh and Arya, 1967, 1973 and 1980) and it was found out that orchard developed at warmer area produced more seeds as compared to colder, frost affected areas. Studies have also been conducted to find out combining ability of different bombax clones (Emmanuel, 1977). Progeny raised from
the crosses between J X I clones was found superior over others. Two biclonal seed orchards have also been raised at New Forest, Dehradun with high yielding and frost resistant characters. Rai has reported in 1986 that 467.172 hec. of seed orchards have been established so far for teak, semul and sandal. This figure has changed and now it is 1,048.61 ha as reported by Sharma et al. (2002) and the number of species has gone up from three to twenty two. In another paper, Katwal (2003) has reported an area of 511 ha for both clonal seed orchard and seedling seed orchard for seventeen priority species. Fertility variation in the teak seed orchard was studies by Nicodemus et al. (2007) and their findings are broad sense heritability was moderate for flowers and fruit production per tree (0.284 to 0.555). A strong
positive correlation was found between flower and fruit production, diameter showed positive correlation with reproductive traits but clear bole height and height to clear bole height were negatively correlated with flowering and fruiting.
5. Progeny Trial
After the selection of superior phenotypes, they are tested for their genetic worth whether they are capable of transmitting their good traits to their progeny or not. This is tested by laying out full sib trial or half sib progeny trial. Based on these trials a plus tree is approved as an elite tree or a clonal seed orchard is rogued or an advance generation seed orchard is established. Progeny testing studies have been carried out and heritability estimates for some characters have been reported for teak, semul, eucalypts and sandal. In case of teak, half sib analysis was done by Rawat et al. (1973) and Kedharnath et al. (1960) have calculated broad sense heritability for height, girth and number of internodes as 1.00, 0.88 and 0.91, respectively. Both half and full sib progeny trials were laid out for bombax (Venkatesh, 1969; Emmanuel, 1977). Half sib progeny trials were also conducted for E. tereticornis, E. camaldulensis, E. grandisM
(Kedarnath and Vakshasya, 1977; Venkatesh and Vakshasya, 1977 and Kedharnath, 1982) and S. album (Bagchi and Kulkarni, 1985 and 1987; Bagchi et al., 1987). Study carried out on 18 half sib progeny of teak on analysis revealed non additive gene action for diameter and basal area (Mandal and Sharma, 1997). Variation in seed characters from clonal seed orchard of teak in Karnataka were studied and high rate of variation was observed (Sindhuveerendra et al., 1997). Chawhaan and Mandal (2006) have estimated heritability of fruit size, fruit weight and seed weight of teak Plus trees from Madhya Pradesh, Orissa and Andhra Pradesh and found it moderate to very high. Chawhaan and Mandal (2007) estimated heritability values for height and girth in G. arborea progeny trial. The values for height and girth were 5.59 and 21.22 and 19.02 and 44.01 percent at individual tree and family level,
respectively. Fifty one progenies of Melia azadirach have been assessed for growth characters and tree number 14 from Takni, Hoshiarpur was found the best (Luna et al., 2006). Chawhaan et al. (2007) studied narrow sense heritability in T. grandis for various characters governing photosynthesis, which ranged from 13.19 to 48. 80 per cent and family heritability of 40.5 and 47.94 per cent. Also studied individual tree and family heritability in T. grandis and found that height and girth showed low heritability and genetic gains estimates, whereas NRA and other traits were highly heritable.
6. Other Variations
Variation is the key factor in any tree improvement programme. Some natural variations observed while working on tree improvement projects of teak, semul, chir pine, sandal, eucalypts and red sanders have been recorded. Polyembryony in B. ceiba (Venkatesh and Emmanuel, 1978) seed and seedling variations including chlorophyll mutants as genetic markers (Venkatesh and Sharma, 1974; Venkatesh and Emmanuel, 1976; Venkatesh and Thapliyal, 1977; Venkatesh et al., 1978; Bagchi and Emmanuel, 1983 and 1984; Shrimati and Emmanuel, 1984; Vakshaysa and Emmanuel, 1984; Bagchi and Kulkarni, 1985; Thapliyal et al., 1985; Vakshaya et al., 1987), phenological and morphological variations (Venkatesh and Sharma, 1977; Kapoor and Sharma, 1978; Venkatesh and Arya, 1978; Venkatesh et al., 1978; Bagchi and Veerender, 1985; Bagchi et al., 1989). With regard to anatomical and wood characters (Kapoor et al., 1973; Kedharnath and Rawat, 1976; Veerender and Bagchi, 1986; Vakshasya et al., 1988) and insect resistance (Kedharnath and Singh, 1975). Intra population variations in Albizia procera were studied for Jabalpur region and significant variations recorded for pod, seed and germination (Gera, 1997). Higher genetic variation was recorded in 20 clones of C. equisitifolia for seed traits
(Balasubramanian and Gurumurthy, 1997). Oil and heartwood content variation recorded in S. album (Arun Kumar, 2007). Highest anthocyanin content in the fruit pulp of tamarind was recorded in T2 selection from Rajapalayam from Tamil Nadu (Natraja Sivam, 2007).
7. Germplasm Collection
The aim of germplasm collection is to conserve the range of variability found in a particular species in respect of various easily recognizable characters as well as other valuable genotypes. Germplasm banks established at New Forest, Dehradun are of T. grandis (20 Clones) and B. ceiba (15 Clones). During Indo Danish Project on Tree Improvement and Seed Procurement assistance has been provided to establish T. grandis germplasm bank at Arunachal Pradesh with 130 clones, Karnataka 118 clones and also at FRI, Dehradun with similar numbers.
8. Biochemical and Genetic Marker
Studies have been conducted on the morphometric traits and isozymes genetic markers on different populations and some good results have been obtained on forest tree species. The important species studied are D. sissoo and P. cineraria (Emmanuel, 1995) and P. roxburghii (Sharma, 2007).
9. Reproductive Biology
Reproductive biology is a very essential part in the tree improvement programme, as all other activities are centered on it. Some of the important species on which work has been done are B. ceiba (Emmanuel, 1977), A. indica (Sharma, 2002), Bruguiera cylindrical (Sophia et al., 2007), Ceriops decandra and Ceriops tagal (Pandiarajan et al., 2007), Pterocarpus dalbergiodes Roxb. (Nagarajan and Kala, 2007) and C. equisetifolia (Nagarajan and Nicodemus, 2007).
Achievements Utilising Induced Genetic Variability
1. Induced Mutagenesis
To study the radio and chemical sensitivity, more than a dozen species have been treated with continuous
and fractionated doses of gamma rays and or chemical mutagens viz. NMU, EMS and hydarzine hydrate at different moisture levels (Kapoor, 1981a; Kapoor, 1981b; Renu Swarup, 1985). Phenovarients have also been identified in A. procera, Dendrocalamus strictus and Populus deltoides which were superior in growth as compared to control (Kapoor and Sharma, 1983; Kapoor, 1986).
2. Induced polyploidy
Techniques for the induction of tetraploids were standerdised for E. tereticornis, D. sissoo, D. latifolia, M. alba and S. album and tetraploids were
developed (Kapoor and Kedharnath, 1970 and 1973; Kapoor, 1981b) The tetraploids were compared with diploids in respect of various morphological and growth parameters (Kapoor and Kedharnath, 1976). Cytological investigations were also carried out (Kapoor, 1981). In mulberry, autotriploids were also produced and a trial was laid out to compare the growth of diploids, triploids and tetraploids. Allotriploids of E. tereticornis X E. grandis were crossed with diploids of E. tereticornis and E. grandis to produce
allotriploids (Kapoor and Sharma, 1987). These allotriploids have shown faster rate of growth during nursery stage (Kapoor and Sharma, 1985). This is the first report of its kind in this genus.
3. Hybridization
In Eucalyptus control hybridization work was
carried out involving different parent species combinations to explore the possibility of
exploiting heterosis (Venkatesh, 1973 and 1977) and also to combine the desirable traits of
the two parent species. Based on crossability pattern, the species selected were E. tereticornis,
E. camaldulensis and E. grandis. Control crosses were attempted between E. tereticornis X
E. camaldulensis (designated as FRI–4) and E. tereticornis X E. grandis (designated as FRI – 6)
(Venkatesh and Sharma, 1975 and 1977a; Venkatesh and Vakshasya, 1977) and F1 hybrids
were produced. Spontaneous natural F1 hybrids of E. camaldulensis X E. tereticornis (FRI–5) and E. grandis X
E. tereticornis (FRI-10) were also picked up. The hybrids FRI-4, FRI-5, FRI-10, E. citriodora x
E. torelliana and E. torelliana X E. citriodora have displayed very high degree of heterosis and
produced 3-5 times more volume than the parent species, inter se comparison between FRI-4 and
FRI-5 a reciprocal hybrids of E. citriodora and E. torelliana was also made (Venkatesh and
Sharma, 1976; Kapoor and Sharma, 1983 and 1984). These hybrids have shown differential response
in heterosis which may be attributed to cytoplasmic effect of the maternal parent (Venkatesh
and Sharma, 1977b). Studies on their morphology and wood properties have also been carried out.
A trispecific hybrid (E. camaldulensis X E. tereticornis) X E. grandis designated as FRI-13 was
also synthesised (Venkatesh and Sharma, 1980). This hybrid did not show much promise so far as
its growth is concerned. Nevertheless, it is a second report of its kind in this genus. Based
on marker characters estimation of inbreeding and effect of inbreeding were studied
(Venkatesh and Sharma, 1984) Second and third generation trials of these
hybrids have been laid out in the field for further selection. Hybridization studies were also
conducted on T. grandis X T. hamiltoniana. The seeds obtained were shriveled, hence,
no further study could be made.
Multiplication and Production of Desired Genotype
1. Conventional Methods
Different methods of vegetative propagation viz. grafting, budding and air layering were standardized for B. ceiba, G. arborea, P. roxburghii, P. patula,T. grandis, E. tereticornis, etc. (Kedharnath and
enkatesh, 1963; Rawat and Kedharnath, 1968; Kedharnath et al., 1976; Kedharnath and Kapoor, 1976; Kapoor et al., 1977; Venkatesh et al., 1978; Kedharnath et al., 1979; Kapoor, 1981; Arya and
Haque, 1982a and 1982b; Vakshasya and Rawat, 1984; Uniyal et al., 1985; Singh and Ansari, 2007).
An interesting observation was noticed particularly in case of cleft grafting in Eucalyptus,
that homoplastic grafts show graft incompatibility. However, when grafting was done on to the
rootstock the graft grew normally as the autoplastic graft. Graft incompatibility has also been
observed while establishing national germplasm bank of teak and bud grafting scion materiel
from different plus trees on to a root-stock of single source (Emmanuel and Bagchi, 1984).
However, this technique has great potential and could be utilised for the establishment of
germplasm banks and clonal seed orchards to produce genetically improved seeds.
2. Micro Propagation Technique
Tissue culture laboratory was established at Forest Research Institute, Dehradun during the year 1986 under the Division of Forest Genetics and Tree Propagation. Protocol for micro propagation of Eucalyptus hybrid has already been standardized. The plants developed have been planted in the field (Renu Swarup and Kapoor, 1988; Kapoor and Chauhan, 1990). This technique has great potential and immense value for mass propagation of genetically improved strains / clones for raising new plantations to increase forest productivity.
The protocols have been developed for mass multiplication of E. tereticornis (Kapoor et al., 1998, Rathore et al., 2006b), Paulownia hybrid (Sharma and Dhiman, 1998), P. fortunei (Sharma et al., 2003), Eucalyptus hybrid – FRI 5 and FRI 14 (Arya, 2006), A. nilotica subsp. indica (Negi et al., 2006), Albizia spp., Bambusa nutans (Kalia et al., 2004, Shirin et al., 2007), Dendrocalamus asper (Arya and Arya, 2006), S. album (Goyal et al., 2006, Rangaswamy and Rathore 2006, Rathore et al., 2006) A. indica, Drepanostachyum falcatum (Sharma and Arya, 2006), Eucalyptus hybrid – FRI 13 (Chouhan and Arya, 2006a), Stevia rebaudiana (Rathi and Arya, 2006), Gymnema sylvestre (Sharma and Arya, 2006), Berberis chitria (Abhinav Kant and Arya, 2006),
D.sissoo (Kalia et al., 2004; Nautiyal and Arya, 2006a), Oroxylum indicum (Arya et al., 2006), Ginkgo biloba (Fulzele and Arya, 2006), Swertia chirata (Bisht et al., 2006), Aristilochia indica (Agarwal et al., 2006), P. roxburghii ( Arvind Kumar and Arya, 2006), Eucalyptus hybrid FRI -6 and FRI -10 (Chauhan et al., 2006), Ptercarpus santalinus, T. grandis, D. stocksii, and Guadua angustifolia (Rathore et al., 2006a), B. bamboos, B. nutans, D. asper and D. strictus (Rathore et al., 2006b), Eucalyptus FRI-10 (Chauhan and Arya, 2006b), Jatropha curcas (Garg and Arya, 2006), B. balcoona Roxb. (Sharma et al., 2006a), Eucalyptus hybrid FRI-5 and FRI-14 (Sharma et al., 2006b), Gigantochloa atter (Nautiyal and Arya, 2006b), B. pallida ( Beena et al., 2006) and G. arborea (Mishra et al., 2006).
3. Clonal Trials
To harvest a yield higher than the normal plantation, it is essential that tested clonal material be used for raising the plantation. Lot of work has been done and also is in progress in this direction. In case of E. camaldulensis and E. tereticornis, thirty selections from 126 trees of superior families in the seedling seed orchard have been made (Varghese, 2007). Intra- and inter-clonal variations of D. sissoo and E. tereticornis have been recorded for growth parameters and wood element dimensions and their relationship (Pande, 2007). It showed that growth has positive impact on wood element dimensions and paper making properties in case of E. tereticornis and also wood element dimensions in D. sissoo, except for vessel member length and specific gravity where growth parameter had shown negative impact. Mayavel et al. (2007) carried out control pollination in twenty clonal selections of tamarind at three different locations resulted in 20 to 70 per cent fruit set. Pande and Dhiman (2006) have reported that wood traits in Populus deltoides vary with the method used for the propagation. Growth is better in cuttings raised plants while fiber length is better in
tissue culture raised plantation woods.
Inference
Tree improvement has completed more than fifty years for some of the species. It is half the rotation age, but if we look towards achievements, they are commendable. Comparing it with agricultural crops is not justified because of some basic differences like trees are wild, have long life span, difficult to access the flowers, locality factors can not be controlled. The most significant difference lies in the interpretation of yield and the additive effect of the annual growth increment, which differentiates it even from horticulture crops. In this article, it has been tried to compile all the research articles or papers published from the ICFRE institutes only, but may be few are left for which the author is regretful. The following trends can be traced:
1. The improvement works could not yield desired results. It may be due to some problem at the implementation stage, documentation or because of low level of research training as identified by Gurumurti (1992) viz. lack of funding overtime; poor library and information services; inadequate interaction with related organisations within and outside the country; inadequate political support for quality seed production and associated research activities within the country and lack of coordination of research efforts within the country.
2. Provenance trials have been initiated for nearly one hundred twenty species. The results for most of the trials are inconclusive and this resulted in colossal loss of important information. The provenance trial has three phases for getting an effective population to be considered as base population for tree improvement work, but this could not be achieved. It is very important to monitor the seed movement, which is very common in our country. This will help in giving some information of adaptability of geographic variations.
3. The seed certification scheme was launched by Indo-Danish Project on Seed Procurement and Tree Improvement (1979a and 1979b) in the year 1976. It was forwarded by the Inspector General of Forests, Govt. of India and could be implemented only in few of the states. The same was the case for the delineation of provenances (1979b), which was a supplementary document to the seed certification scheme. This would have helped in seed movement from one zone to another and also helped in assessing the adaptability of seeds brought from different zones. As it is said better late than never, so is with the seed certification scheme. If the productivity of the forests is to be increased, seed certification scheme has to be implemented and monitored. The preliminary requirement for the scheme is available with all the state forest departments.
4. The low productivity of our seed orchards creates frustration in the mind of field foresters and scientists. There is a need to look into the factors especially management practices, seed orchard site, clones, their environmental interaction, etc. If we could have established seed orchards of the plus trees selected in the particular seed zone, may be the seed yield could have been different.
5. Clonal trials is another area where one has to look as to how best they can be utilised. The countries where high productivity has been recorded for forests, it is only due to the clonal plantations not with seed plantations. raised.
Care must be taken regarding site suitability of clones, for example, clones suited best in Dehradun conditions should not be recommended for drier tracts of Jodhpur. Such experiments only waste money and time. Clones must be tested depending upon the agroclimatic conditions and later on planted only on the sites where high management practices could be adopted.
6. Planting sites should be marked for-a) commercial purposes, b) maintaining variability in the population and c) conservation of germplasm. Even at the Council level also, germplasm conservation plots must also be marked because these variabilities will only come to our help in the time of distress.
7. The changing environment is a challenge especially for the forest geneticists and tree improvement scientists. There could be two points, which may be considered - one is preserving our genetic variations and second inducing variability through genetically modified trees i.e. GM trees. There is a necessity for it because our fertile lands have been converted into saline, alkaline and sodic areas due to faulty production practices. The only alternative is to have trees which can grow in these areas and reclaim them back.
8. The documentation of plus trees, elite trees, CPTs, seed production areas, seedling seed orchard, clonal seed orchards and vegetative multiplication gardens is essential as different authors have quoted different terms in their articles.
9. There should be a central agency regulating therelease of varieties and clones identified for
different agroclimatic zones.
References
Abhinav Kant and Arya, I.D. 2006. In vitro shoot regeneration from nodal explant of Berberis chitra Lindl.: An endangered medicinal plant. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 27.
Abhinav Kant; Harsh, N.S.K. and Arya, I.D. 2006. Problem of deep seated fungal infection in tissue culture of Melocanna baccifera (Roxb.). In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 64.
Agarwal, Poonam; Dubey, Abhay Kumar; Rathore, T.S.; Beena, D.B. and Kabade, Umesh A. 2006. Studies on the effect of different carbohydrate sources on the rapid micropropagation of Aristilochia indica (L) – A medicinally important over exploited species. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 60.
Arun Kumar, A.N.; Joshi, Geeta and Rathor, T.S. 2007. Redefining tree improvement strategies in Sandalwood (Santalum album L.). In: National Conference on Increasing Forest Productivity: Genetics and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Arvind Kumar and Arya, Sarita. 2006. In vitro regeneration pathways in chir-pine (Pinus roxburghii). In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique:Abstracts.Dehradun,Forest Research Institute. p. 63.
Arya, I.D. and Arya, Sarita. 2006. Introduction and establishment of exotic edible bamboo Dendrocalamus asper in India: Rapid and mass multiplication through tissue culture technology. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. pp 3-4.
Arya, R.S. and Haque, M.S. 1982a. Grafting and budding in Gmelina arborea Roxb. Indian Forester, 108: 497-500.
Arya, R.S. and Haque, M.S. 1982b. Air layering in Pinus patula Schl. and Pinus caribea var. Hondurensis. Indian Forester, 108: 466.
Arya, Sarita. 2006. Micropropagation of economically
important forest trees and medicinal plants. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 5.
Arya, Sarita and Fulzele, Kavita and Bist, Prabha. 2006. Tissue culture studies on Oroxylum indicum Vent. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 28.
Bagchi, S.K. 1983. Guidelines for the selection of Bombax ceiba plus trees. Coimbatore, Indo-Danish Project on Seed Procurement and Tree Improvement.
Bagchi, S.K. 1986. Possible correlations between oil percentage and anatomical variability in Santalum album. In: 2nd Forest Products Conference, Dehradun, 26-27 May 1986. Proceedings. Dehradun, Forest Research Institute.
Bagchi, S.K.; Choubey, A.K. and Kulkarni, U.D. 1987.Variability analysis among half-sib seedlings of Santalum album. Indian Forester, 113 (3): 370-374.
Bagchi, S.K. and Emmanuel, C.J.S.K. 1984. Analysis of variability for pod length and seed count in Albizia lebbek Benth. My Forest, 20: 85-89.
Bagchi, S.K. and Kulkarni, H.D. 1987. A note on seedling abnormality frequency in the half-sib progenies of Santalum albu. Indian Forester, 113 (9): 650-651.
Bagchi, S.K.; Sharma, V.P. and Gupta, P.K. 1989. Developmental instability in leaves of Tectona grandis, Silvae Genetica, 38: 1-6.
Bagchi, S.K. and Veerendra, H.C.S. 1985. Study on intra tree and inter tree variations in leaves of Santalum album Lin. My Forest, 21: 33-39.
Balasubramanian, A. and Gurumurthy, K. 1997. Clonal variability on seed traits in Casuarina equisitifolia. In: IUFRO Symposium on Innovations in Forest Tree seed Science and Nursery Technology, Raipur, 22-25 November 1997. Abstracts. Raipur, Pt. Ravishankar Shukla University.
Beena, D.B.; Rathore, T.S.; Kabade, Umesh A. and Dubey, A.K. 2006. In vitro cloning through axillary shoot proliferation from the explants of field grown candidate plus clumps of Bambusa pallida Munro. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p 128.
Bisht, Prabha; Bisht, Ruma and Chauhan, J.M.S. 2006. Development of tissue culture (micropropagtion) protocol for clonal multiplication and germplasm conservation of Swertia chirata Buch.-Ham.: A plant of medicinal importance. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest
Research Institute. p 59.
Chauhan, Sudhir and Arya, I.D. 2006a. Development of in vitro protocol for promising interspecific F1 trispecific hybrid of Eucalyptus FRI – 13 (E. camaldulensis X E. tereticornis ) X E. grandis. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 24.
Chauhan, Sudhir and Arya, I.D. 2006b. In vitro cloning of F1 hybrid of MEucalyptus FRI-10 (E. grandis X E. tereticornis) through new approach: Tissue culture technique. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute.
Chauhan, Sudhir; Sharma, Reetu; Kamal, Barkha and Arya, I.D. 2006. Seasonal Effect on axillary bud break and phenolics exudation in F1 hybrids of Eucalyptus (FRI-6 and FRI- 10). In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 90.
Chawhaan, Pravin H. and Mandal, A.K. 2006. Genetic variation, heritability and characters association of fruit and seed parameters in teak (Tectona grandis L.f.) implications in seed production programme. In: National Symposium on Tree Improvement for Sustainable Forestry, Jabalpur, 2006. Abstracts. Jabalpur, Jawaharlal Nehru Krishi Vishwa Vidyalaya.
Chawhaan, Pravin H. and Mandal, A.K. 2007. Early evaluation of open pollinated progeny trail of Gmelina arborea. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February, 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Chawhaan, Pravin H.; Kumar, P.; Ansari, S.A.; Khobragade, N.D. and Mandal, A.K. 2007. Half sib genetic analysis for growth, photosynthesis and nitrate reductase activity (NRA) in teak (Tectona grandis L.f.). In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February, 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Chawhaan, Pravin H.; Kumar, P.; Tiwari, A.; Ansari, S.A. and Mandal, A.K. 2007. Genetic variation, inheritance and inter relationship of carbon anhydrase and photosynthesis in teak (Tectona grandis L.f.). In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February, 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Emmanuel, C.J.S.K. 1977. Cytomorphological, embryological and genetical studies on Bombax ceiba L. Post M. Sc. research report. Forest research Institute and Colleges, Dehradun.
Emmanuel, C.J.S.K. 1995 Final report for the FAO fellowship under the project IND/92/038/A/01/99 for the period from 21.03.1994 to 20.03.1995 [ unpublished].
Emmanuel, C.J.S.K. 2001. International Neem Network report for Arid Forest Research Institute, Jodhpur, In: Workshop on Data Analysis of the International Neem Network, Jodhpur, 2001. Proceedings. Jodhpur, Arid Forest Research Institute. pp. 48-64.
Emmanuel, C.J.S.K. 2003. Role of genetic selection, gene conservation, provenance trials and hybridization with special reference to Gmelina arborea. In: Gmelina arborea Round Table Conference, Jorhat, 2003. Proceedings. Jorhat, Rain Forest Research Institute.
Emmanuel, C.J.S.K. and Bagchi, S. 1984. Stock-scion compatibility in teak (Tectona grandis). Silvae Genetica, 33: 53-56.
Emmanuel, C.J.S.K. and Bagchi, S. 1988. Teak plus tree selection in South India. In: National Symposium on Advances in Tree Sciences, Dehradun, 11-12 April 1983. Trends in tree sciences: Proceedings edited by P.K. Khosla and R.N. Sehgal. Solan, ISTS. pp. 268-271.
Emmanuel, C.J.S.K.; Gaye, A.; Boontawee, B. and Thomsen, A. 1997. International Neem Network - Assessment of international neem provenance trials 1. Core characters, years 1-5. In: Working Group on Trial Assessment. Rome, Food and Agriculture Organisation of the United Nations.
Emmanuel, C.J.S.K; Kapoor, M.L. and Sharma, V.K. 1990. Achievements of tree improvements and their significance in gene conservation. Journal of Economic Botany and Phytochemistry, 1: 48-54
Emmanuel, C.J.S.K. and Tomar, U.K. 2002. Neem improvement works at Arid Forest Research Institute, Jodhpur In: World Neem Conference, Mumbai, 27 to 30 November 2002. Proceedings. Mumbai, Neem Foundation.
Fulzele, Kavita and Arya, Sarita 2006. In vitro culture establishment and multiplication of Ginko biloba L.: A living fossil. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 30.
Garg, Shilpi and Arya, Sarita. 2006. Attempts for clonal multiplication of high oil yielding Jatropha curcas. In: National Symposium on Plant Biotechnology: In Vitro Regeneration and Cloning Technique, Dehradun, 12-14 October 2006. Abstracts. Dehradun, Forest Research Institute. p 125.
Gera, Neelu. 1997. Intra population variation in Albizia procera: Pod, seed and germination characters. In: IUFRO Symposium on Innovations in Forest Tree seed Science and Nursery Technology, Raipur, 22-25 November 1997. Abstracts. Raipur, Pt. Ravishankar Shukla University.
Goyal, Biniya; Rathore, T.S. and Dubey, Abhay Kumar. 2006. Effect of sucrose, agar concentrations and pH on shoot multiplication in Santalum album L. from explants of mature trees. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun,Forest Research Institute. pp. 12-13.
Gurumurti, K. 1992. Baseline studies and basic approaches to tree improvement networking. In: National Network Inception Workshop on Improved Productivity of Man-Made Forests Through Application of Technical Advances in Tree Breeding.
Indo-Danish Project on Seed Procurement and Tree Improvement, Hyderabad 1979a. Certification of forest reproductive material in India. The author.
Indo-Danish Project on Seed Procurement and Tree Improvement, Hyderabad 1979b. Certification of forest reproductive material in India: Seed zoning system followed in India. The author.
Kalia, S.; Kalia, R.K. and Sharma, S.K. 2004a. Evaluation of clonal variability in shoot coppicing ability and in vitro responses of Dalbergia sissoo Roxb. Silvae Genetica, 53 (5-6): 212-220.
Kalia, S.; Kalia, R.K. and Sharma, S.K. 2004b. In vitro regeneration of an indigenous bamboo (Bambusa nutans) from internode and leaf explant. Journal of Bamboo and Rattan, 3(3): 217-228.
Kapoor, M.L. 1981a. Studies on induced polypioidy and mutagenesis in some hardwood tree species: PL-480 Project Final Technical Report. Dehradun, Forest Research Institute.
Kapoor, M.L. 1981b. A technique of chromosomal count from developing leaf buds of induced tetraploid and diploid Santalum album L. Indian Forester, 107(5): 60-62.
Kapoor, M.L. 1986. Experimental genetic manipulation of forest tree for plantation. In: National Symposium on Plantation Opportunities in India, New Delhi, 1986. Proceedings. New Delhi, Hindustan Lever Research Foundation. pp. 181-185.
Kapoor, M.L. and Kedharnath, S. 1970. Induction of tetraploidy in Dalbergia sissoo Roxb. and D. latifolia Roxb. In: Seminar-cum-Workshop on the Genetic Improvement of Forest Tree Seeds in India, Dehradun, 7-12 February 1970. Proceedings. Dehradun, F.R.I. and Colleges. pp. 95-97.
Kapoor, M.L. and Kedharnath, S. 1973. Induced tetraploidy in S. album and E. tereticornis, Indian Journal of Genetics and Plant Breeding, 34A: 408-412.
Kapoor, M.L. and Kedharnath, S. 1976. Change in leaf morphology in experimentally synthesized autotetraploids of sandal wood. Indian Forester, 102 (8): 495-497.
Kapoor, M.L. and. Sharma, K.K. 1978. Triplet seedlings in Caribbean pine. Indian Forester, 104 (8): 572-573.
Kapoor, M.L. and Sharma, V.K. 1983a. Evolving genetically improved clones of popular by mutation breeding. Indian Forester, 109: 748-754.
Kapoor, M.L. and Sharma, V.K. 1983b. Studies on the effect of hybridization between Eucalyptus citriodora and Eucalyptus torelliana. Indian Forester, 109 (12): 891-900.
Kapoor, M.L. and Sharma, V.K. 1984. Hybrid between Eucalyptus citriodora Hook and E. torelliana F.V. Muell in India. Silvae Genetica, 33: 42-46.
Kapoor, M.L. and Sharma, V.K. 1985. Experimentally systhesised allote traploids in Eucalyptus Silvae Genetica, 34:19-22.
Kapoor, M.L. and Sharma, V.K. 1987. Experimentally synthesized allotriploids in Eucalyptus. Journal of Tree Sciences, 6(2): 84-88.
Kapoor, M.L.; Bisht, Prabha; Chouhan, J.M.S.; Joshi, Ila; Sharma, S.K. and Bagchi, S.K. 1998. Improved planting stock of Eucalyptus tereticornis: A protocol for mass multiplication through tissue culture. Dehradun, Forest Research Institute.
Kapoor. M.L; Vakshasya, R.K. and S. Kedharnath. 1977. Field grafting studies in Pinus patula. Indian Forester, 103 (6): 397-402.
Katwal, R.P.S.; Srivastava, R.K.; Kumar, S. and Jeeva, V. 2003. State of forest genetic resources conservation and management in India. In: Asia Pacific Forest Genetic Resources Programme (APFORGEN) Inception Workshop, Kepong, 15-18 July 2003. Forest Genetic Resources Conservation and Management: Proceedings. Serdeng, IPGRI. pp. 49-77.
Kedharnath, S. 1982a. Genetic variation and heritability of juvenile height growth in Eucalyptus grandis. Journal of Tree Sciences, 1 (1-2): 46-49.
Kedharnath, S. 1982b. Plus tree selection -A tool in forest tree improvement. In: National Symposium on Improvement of Forest Biomass, Solan, 20-21 November, 1980. Improvement of forest biomass edited by P.K. Khosla. Solan, ISTS. pp. 13-20.
Kedharnath, S. and Singh, Pratap 1975. Studies on natural variations in susceptibility of Tectona spp. to leaf skeltonizer Pyrausta machaeralis. In: 2nd FAO/IUFRO World Consultation on Forest Disease Insect, New Delhi, 7-12 April 1975. Proceedings and recommendations. Rome, FAO.
Kedharnath, S. and Venkatesh, C.S. 1963. Grafting as an aid in the breeding of teak (Tectona grandis L.f.) and semul (Salmelia malabarica Schott et End.). Rome, FAO.
Kedharnath, S.; Kapoor, M.L. and Vakshasya, R.K. 1979. A note on field grafting trials in chir pine. Indian Forester, 105(4): 301-304.
Kedharnath, S.; Ramanathan Chetty, C.K. and Rawat, M.S. 1960. Estimation of genetic parameters in teak (Tectona grandis L.f) without raising progenies. Indian Forester, 95: 238-245.
Kedharnath, S.; Rawat, M.S. and Chouhan, V.S. 1970. Early growth performance of twenty clones of teak (Tectona grandis L.f.) in a seed orchard. In: Seminar-cum-Workshop on the Genetic Improvement of Forest Tree Seeds in India, Dehradun, 7-12 February 1970. Genetic improvement of forest tree seeds in India: Proceedings. Dehradun, Forest Research Institute and Colleges. pp. 86-89
Kedharnath, S.; Rawat, M.S.; Uniyal, D.P. and Kantham, D.L. 1976. Studies on field grafting and the growth of grafts in red sanders. Indian Forester, 102: 761-765.
Luna, R.K.; Singh, Bikram and Sharma, S.K. 2006. Assessment of 51 progenies of Melia azedarach Linn – A promising agroforestry tree. Indian Forester, 132 (8): 941-956.
Mandal, A.K. and Sharma, Rajesh. 1997. Genetic analysis of teak (Tectona grandis) clones of Maharashtra origin., In: IUFRO Symposium on Innovations in Forest Tree seed Science and Nursery Technology, Raipur, 22-25 November 1997. Abstracts. Raipur, Pt. Ravishankar Shukla University.
Mathew, J.D. 1961. A programme of forest genetic and forest tree breeding. Rome, FAO.
Mayavel, A.; Nagarajan, B. and Kumaravelu, G. 2007. Enhancing flowering and full sib family production in high yielding tamarind selections of Tamil Nadu. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Mishra, Yogeshwar; Rana, P.K. and Joshi, M.K. 2006. In vitro multiplication of Gmelina arborea Roxb. from mature trees. In:National Symposium on Tree Improvement for Sustainable Forestry, Jabalpur, 2006. Jabalpur, Jawaharlal Nehru Krishi Vishwa Vidyalaya.
Mugal, A.H. and Thapliyal, R.C. 2006. Provenance variation in cone and seed characteristics of Cedrus deodara,M In: National Symposium on Tree Improvement for Sustainable Forestry, Jabalpur, 2006. Abstracts. Jabalpur, Jawaharlal Nehru Krishi Vishwa Vidyalaya.
Muniswamy, K.P. 1978. Guidelines for the selection and approval of teak plus trees based on phenotypic superiority. Secunderabad, DANIDA.
Nagarajan, B. and Kala, N. 2007. Reproductive biology of Andaman padauk, In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Nagarjuna, B. and Nicodemus, A. 2007. Reproduction in Casuarina equisetifolia. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Natraja Sivam, N.R.; Nagarajan, B.; Laxman, Aparna and Mayavel, A. 2007. Red tamrind – A potential forest genetic resource. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Nautiyal, Sangeeta and Arya, Sarita 2006a. Tissue culture studies on Dalbergia sissoo Roxb., In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 29.
Nautiyal, Sangeeta and Arya, Sarita. 2006b. In vitro response of nodal explants in black bamboo Gigantochloa atter Hassk. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 127.
Nayal, B.S. and Rawat, M.S. 1984. Guidelines for the improvement of Acacia catechu, A. auriculiformis and A. tortilis. Dehradun, Indo-Danish Project on Seed Procurement and Tree Improvement Centre.
Negi, Usha; Parveen and Tomar, U.K. 2006. Factors affecting different micropropagation stages of adult Acacia nilotica subsp. indica Brenan tree. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 14.
Nicodemus, A.; Varghese, M.; Nagarajan, B. and Durai, A. 2007. Annual fertility variation in clonal seed orchards of teak (Tectona grandis L.f.) and its impact on seed crop. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Proceedings. Jabalpur, Tropical Forest Research Institute.
Pande, P.K. 2007. Impact of growth on wood properties and specific gravity and their variations in clonal plantation woods of Dalbergia sissoo Roxb. and Eucalyptus tereticornis Sm. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Proceedings. Jabalpur, Tropical Forest Research Institute.
Pande, P.K. and Dhiman R.C. 2006. Wood anatomical variations in Populus deltoids Bartr. Ex Marsh.: Micro vs macro–propagated plantations woods. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 121.
Pandiarajan, C.; Nagarajan, B.; Krishnamorthy, M. and Sophia, P. 2007. Reproduction in Ceriops: Strategies. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Proceedings. Jabalpur, Tropical Forest Research Institute.
Rangaswamy, Mamatha and Rathore, T.S. 2006. Studies on the effect of different carbohydrate sources on the somatic embryogenesis in Santalum album L. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 21-22.
Rao, U.S. 1950. Genetics and forest tree improvement. Indian Forester, 77: 35-647.
Rathi, Neelima and Arya, Sarita. 2006. Micropropagation for rapid and mass multiplication of Stevia rebaudiana (Bet.) Bertoni – A natural sweetner. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p. 25.
Rathore, T.S.; Kabade, Umesh A.; Somashekar, P.V.; Dubey, A.K.; Beena, D.B.; Jadish, M.R. and Vishvanath, S. 2006. Rapid micropropagation of important species of Bamboo for production of quality planting material, establishment of field trials and their evaluation. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. pp. 115-116.
Rathore, T.S.; Sanjay; Somashekar, P.V.; Rangaswamy, Mamatha; Goyal, Biniya; Kabade, A., and Dubey, Abhay Kumar. 2006. Rapid micropropagation of selected species of trees and bamboo. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. pp. 110-111.
Rawat, M.S. 1983. Guidelines for establishment of seed production areas of shisham (D. sissoo). Dehradun, Indo-Danish Project on Seed Procurement and Tree Improvement Centre.
Rawat, M.S. 1984. Guidelines for the improvement of Prosophis juliflora. Dehradun, Indo-Danish Project on Seed Procurement and Tree Improvement Centre.
Rawat, M.S. and Kedharnath, S. 1968. Field grafting and budding in teak (Tectona grandis L.f.), Indian Forester, 94 (3): 259-262.
Rawat, M.S. and Uniyal, D.P. 1982. Criteria for plus tree selection in chir, kail, deodar, fir, spruce and Prosopis. Dehradun, Indo Danish Project on Seed Procurement and Tree Improvement Centre.
Rawat, M.S.; Lakshmikantham, D. and Kedharnath, S. 1984. Bud grafting and growth of grafts in teak. In: First Forestry Conference, Dehradun, 6-10 December 1973. Proceedings, vol. 2. Delhi, Controller of Publications. pp. 429-432.
Rawat, M.S.; Uniyal, D.P. and Vakshasya, R.K. 1987. Guidelines for the establishment of provenance trials of Acacia nilotica, Azadirachta indica, Albizia procera, Dalbergia sissoo, Tamarindus indicus, Madhuca latifolia and Salix tetrasperma. Dehradun, Indo-Danish Project on Seed Procurement and Tree Improvement Centre.
Renu Swarup. 1985. Studies on combined effect of physical and chemical mutagens on Eucalyptus hybrids. Ph. D. thesis, Garwal University, Srinagar.
Renu Swarup and M.L. Kapoor. 1988. In vitro clonal propagation of Eucalyptus hybrid (E. torelliana X E. citriodora). In: Biotec India 88, New Delhi, 4th October 1988. Proceedings. New Delhi, Biotech India.
Sharma, Deepa, and Arya, I.D. 2006. In vitro culture establishment of Gymnema sylvestre R. Br.- A medicinal plant. In: In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p 26.
Sharma, M.K.; Singhal, R.M.; Sudhir Kumar and Jeeva, V. 2002. Regional updates for India. In: Twelfth Session of the FAO Panel of Experts on Forest Gene Resources, Rome, Italy, 21-23 November 2001. Forestry genetic resources working papers. Rome, FAO.
Sharma, Rajesh. 2007. Variation studies in provenances and plus trees of Pinus roxburghii. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Sharma, Reetu and Arya, I.D. 2006. Somatic embryogenesis and plant regeneratiobn in hill bamboo: Drepanostachyum falcatum. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p 23.
Sharma, Reetu; Satsangi, Richa; Sharma, Deepa and Arya, I.D. 2006. In vitro shoot multiplication of Bambusa balcooa Roxb. through nodal explant. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p 124.
Sharma, S.K. 2002. Seed source variation and reproductive biology of Azadirachta indica (A. Juss.). Ph. D. thesis. Forest Research Institute Deemed University, Dehradun. 194 p.
Sharma, S.K. and Dhiman, R.C. 1998. In vitro clonal propagation of F1 hybrid of Paulownia (P. fortunei X P. tomentosa). Phytomorphology, 48(2): 167-172.
Sharma, Sudhir; Chauhan, Sudhir and Arya, I.D. 2006. In vitro rapid multiplicatiojn of F1 hybrids of Eucalyptus FRI-5 (E. camaldulensis Dehn. X E. tereticornis SM) and FRI-14 (E. torelliana F.V. Muell X E. citriodora Hook) and their field trial. In: National Symposium on Plant Biotechnology, Dehradun, 12-14 October 2006. In vitro regeneration and cloning technique: Abstracts. Dehradun, Forest Research Institute. p 126.
Shirin, Fatima; Yadav, Suman; Patel, Pradeep and Ansari, S.A. 2007. Micropropagation of Bambusa nutans Wall. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Sindhuveerendra, H.C.; Rao, R.V. and Ananthapadmanabha, H.S. 1997. Variation in seed characteristic of clones of Tectona grandis L.f. (teak). In: IUFRO Symposium on Innovations in Forest Tree Seed Science and Nursery Technology, Raipur, 22-25 November 1997. Abstracts. Raipur, Pt. Ravishankar Shukla University.
Singh, B. Gurdev; Mandal, A.K.; Sivakumar, V.; Anandalakshmi, R.; Warrier, Rekha R. and Shanthi, K. 2007. Selection and propagation of Azadirachta indica A. Jiss. (neem) trees. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Singh, Sanjay and Ansri, S.A. 2007. Cloning mature ortets of Gmelina arborea through rejuvenated minicuttings. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Sophia, P.; Nagarajan, B.; Pandiarajan, C. and Krishnamoorthy, M. 2007. Phenological and reproduction in Bruguiera cylindrical. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Srimathi, R.A. and Emmanuel, C.J.S.K. 1984. A conjointed quadruplet teak seedling. My Forest, 20(4): 245.
Srimathi, R.A. and Emmanuel, C.J.S.K. 1996. Improved teak seed management and economics. Journal of Tropical Forestry, 12: 261-266.
Thapliyal, R.C.; Uniyal, D.P. and Rawat, M.S. 1985. Variation in germination characteristics of some seed origins of Pinus wallichiana A.P. Jacks from the western Himalayas. Proceedings of the Indian Academy of Sciences (Plant Sciences), 95: 441-451
Thapliyal, R.C.; Vakshasya, R.K.; Uniyal, D.P. and Rawat, M.S. 1988. Tree improvement activities in Himachal Pradesh, I: Selection of chir pine (Pinus roxburghii) stands and some suggestions for follow up action, II: Collection and testing of kail (Pinus wallichiana) seeds. In: Interaction Seminar with Himachal Pradesh Forest Officers, Shimla, 5-9 September 1988. Papers. Shimla, H.P. Forest Department.
Uniyal, D.P. and Rawat, M.S. 1997. Clonal seed orchard: Problems and perspective in improvement of teak (Tectona grandis L. f.). In: IUFRO Symposium on Innovations in Forest Tree seed Science and Nursery Technology, Raipur, 22-25 November 1997. Abstracts. Raipur,Pt. Ravishankar Shukla University.
Uniyal, D.P.; Thapliyal, R.C. and Rawat, M.S. 1985. Vegetative propagation of sandal by root cuttings. Indian Forester, 111: 145-148.
Vakshasya, R.K. 1973. Natural variability in respect of some provenances of Eucalyptus camaldulensis Dehn. established at New Forest Estate. Dehradun, Forest Research Institute.
Vakshasya, R.K. 1988. Growth and foliar variation among provenances of Eucalyptus camaldulensis Dehn. grown at Dehradun. Proceedings of the Indian Academy of Sciences (Plant Science). 98: 507-518.
Vakshasya, R.K. and Emmanuel, C.J.S.K. 1984. An abnormal seedling in teak. Indian Forester, 110(5): 497-498.
Vakshasya, R.K. and Rawat, M.S. 1984a. Guidelines for the improvement of Albizia lebbek. Dehradun, Indo-Danish Project on Seed Procurement and Tree Improvement Centre.
Vakshasya, R.K. and Rawat, M.S. 1984b. Somatic multiplication in Eucalyptus camaldulensis through leafy cuttings. Indian Forester, 110(1): 56-60.
Vakshasya, R.K. and Rawat, M.S. 1985. Evolution of budding and field planting period for teak seed orchard establishment. Indian Forester, 111(5): 328-332.
Vakshasya, R.K.; Rajora, O.P. and Rawat, M.S. 1986. Seed and seedling traits of Dalbergia sissoo Roxb. quantitative variation among ten sources in India. Silvae Genetica, 35(5-6): 247-248.
Vakshasya, R.K.; Uniyal, D.P. and Rawat, M.S. 1980. Guidelines for seed orchard establishment and management. Dehradun, Indo-Danish Project on Seed Procurement and Tree Improvement Centre.
Vakshasya, R.K.; Uniyal, D.P. and Rawat, M.S. 1988. Teak plus tree for specific traits. Indian Forester, 114: 168-169.
Varghese, Mohan. 2007. Breeding Eucalyptus camaldulensis and E. tereticornis for improved productivity in India. In: National Conference on Increasing Forest Productivity: Genetic and Breeding Options, Jabalpur, 21-23 February 2007. Abstracts. Jabalpur, Tropical Forest Research Institute.
Veerendra, H.C.S. and Bagchi, S.K. 1986. Analysis of inter-tree variability in anatomical characters of Santalum album. Indian Forester, 112(1): 80-84.
Venkatesh, C. S. 1969. The early growth form of certain half-sib progenies of Bombax ceiba L. In: 2nd World Consultation on Forest Tree Breeding, Washington D.C. 7-10 August 1969. Proceedings. IUFRO.
Venkatesh, C. S. 1973. Hybridisation techniques in Forest tree improvement: Project report on a six monthly visit to Canada under Colombo Plan Fellowship. 31 p.
Venkatesh, C. S. 1974. Role of exotics in the genetic improvement of forest tree species in Asian and Oceania. Indian Journal of Genetics and Plant Breeding, 34 A: 359-366.
Venkatesh, C. S. 1981. Strategies of genetic gain through seed orchard. In: Khosla, P.K. Ed. Advances in forest genetics, New Delhi, Ambika Publications. pp. 39-46.
Venkatesh, C. S. and Arya, R.S. 1967. Observations on the flowering and fruiting behavior of semul grafts. Indian Forester, 93: 586-587.
Venkatesh, C. S. and Arya, R.S. 1978. On the occurrence of unisexual male flowers in the red silk cotton tree (Bombax ceiba L.). Indian Forester, 104: 367-368.
Venkatesh, C. S. and Arya, R.S. 1980. Establishment, management and productivity of Bombax ceiba L. grafted seed orchard. Indian Journal of Forestry, 3(2): 103-110.
Venkatesh, C. S. and Arya, R.S. 1984. Flowering and fruit set in a clonal seed orchard of semul. In:First Forestry Conference, Dehradun, 6-10 December 1973. Proceedings vol. 2. Delhi, Controller of Publications. pp. 433-435.
Venkatesh, C. S. and Emmanuel, C.J.S.K. 1976. Spontaneous chlorophyll mutations in Bombax L. Silvae Genetica, 25: 137-139.
Venkatesh, C. S. and Emmanuel, C.J.S.K. 1978. Twin seedlings in Bombax ceiba L. (Bombacaceae). Indian Forester, 104: 411-413.
Venkatesh, C. S. and Sharma, V.K. 1974. Some unusual seedlings of Eucalyptus: Their genetic significance and value in breeding. Silvae Genetica, 23: 120-124.
Venkatesh, C. S. and Sharma, V.K. 1975. The flowering phenology of some Eucalyptus at New Forest, its significance and implications in hybridisation. Journal of Indian Academy of Wood Science, 6: 191-121.
Venkatesh, C. S. and Sharma, V.K. 1976. Heterosis in the flowering precocity of Eucalyptus hybrids. Silvae Genetica, 25: 28-29.
Venkatesh, C. S. and Sharma, V.K. 1977a. Hybrid vigour in a controlled interspecific crosses of Eucalyptus tereticornis X E. camaldulensis. Silvae Genetica, 26: 121-124.
Venkatesh, C. S. and Sharma, V.K. 1977c. Rapid growth rate and higher yield potential of heterotic Eucalyptus species hybrids FRI-4 and FRI-5. Indian Forester, 103: 795-802.
Venkatesh, C. S. and Sharma, V.K. 1979. Comparison of a Eucalyptus tereticornis X E. Grandis controlled hybrid. Silvae Genetic, 28: 227-230.
Venkatesh, C. S. and Sharma, V.K. 1980. An artificial trispecific Eucalyptus hybrid (E. camaldulensis Dhen. X E. tereticornis Sm.) X E. grandis Hill ex Maiden. Euphytica, 29(2): 451-458.
Venkatesh, C. S. and Sharma, V.K. 1984. Eucalyptus improvement by selection and hybridisation. In: First Forestry Conference, Dehradun, 6-10 December 1973. Proceedings vol. 2. Delhi, Controller of Publications. pp. 421-423.
Venkatesh, C.S. and Vakshasya, R.K. 1979. Provenance variation in some floral characters of Eucalyptus camaldulensis Dhen. Indian Journal of Forestry, 2: 16-64.
Venkatesh, C. S.; Arya, R.S. and Emmanuel, C.J.S.K. 1978. A note on air layering and budding in semul. Indian Forester, 104: 142-144.
Venkatesh, C. S.; Arya, R.S. and Sharma, V.K. 1973. Natural selfing in planted Eucalyptus and its estimation. Journal of Plantation Crops, 1: 23-25.
Venkatesh, C. S.; Arya, R.S. and Sharma, V.K. 1977. An ornamental red flowered variant tree of Eucalyptus tereticornis Sm. Journal of Bombay Natural History Society, 74: 570-571.
Venkatesh, C. S.; Arya, R.S. and Thapliyal, R.C. 1978. An albino type natural chlorophyll mutant in Gmelina arborea Roxb. Silvae Genetica, 27(1): 40-41.
Venkatesh, C. S.; Kumar, A. ; Gupta, B.N. and Vakshasya, R.K. 1978. Precocious flowering of 2-3 year old Japanese red pine sapling at Dehradun. Silvae Genetica, 27(5): 209-210.
|
PERSPECTIVES ON FOREST CERTIFICATION: A US CASE STUDY
Establishment of forestland certification systems
marks a significant development in global forestry sector during the past decade. The
possibility of implementing similar system in India and other developing countries in the
future is not ruled out, considering the globalisation of environment and forestry policies and
practices.
However, a survey in Minnesota state in the USA showed
that only 4 per cent of family forest owners wanted to certify their forests, and 19 per cent
were sure they would not want to do so. Approximately, two-thirds could be regarded as ‘
persuadable’. Lack of awareness, interests, choice available in selection of logger,
etc. are some of the factors behind poor response of forestland owners. Landowners
favoured a certification system that doest not require them to hire professional foresters
in conducting forest managment activities on their land. A certifying organisation affiliated
with forestland owner association on educational institution was more acceptable than that with
government organisation. Cost of certification too proved to be a deterrent factor: at
certification cost of US $1 per acre per year, 48 per cent respondents were willing to get
their forestland certified while only 3 per cent were willing to pay for forest certification
at a certification cost of atleast US $6 per acre per year. Certifying logging business
represented a more realistic and cost-effective approach than certifying individual family
forest owners. Responses of different classes of respondents viz. those in favour of, against
and neutral vis-à-vis several certification options are available in the article ‘Assessing
Family Forestland Certification Opportunities: A Minnesota Case Study’ authored by Michael A.
Kilgore et al. in January-February 2007 issue of the Journal of Forestry.
The findings of this study can be extremely useful
in appraisal of interests of forest landowners in certification for a given location.
Certification benchmarks forestland management and logging policies and practices against
predetermined standards to guide management of forest resources for desired tangible and
intangible benefits. The study, therefore, has significant relevance for the planners.
|
GENETIC IMPROVEMENT OF POPULUS IN INDIA: A CASE STUDY
D.K. Khurana
Dr. Y. S. Parmar University of Horticulture and Forestry, Nauni, Solan– 173 230
I
ndia, a vast country with diverse climate, had rich forest resource,
which has now declined to about 68.97 million ha and thus
amounting for only 22.5 per cent of its total land area (WIMCO Seedlings, Ltd., 2002).Its
tangible and non-tangible benefits cannot be gauged in terms of revenue only, since the
non-tangible benefits of conservation and environmental services are non-measurable factor.
However, as per forest policies, India must have 33 per cent of its area under forests. To
achieve these targets by the year 2010 currently 3,020 million seedlings are being planted
every year in India. However, these massive forestation drives would be futile, if we cannot
judiciously convert this opportunity to improve the quality of the plantations and thus enrich
our resources and future plantations by making them more productive and consequently more
profitable. This cannot be achieved unless we use the quality and genetically improved planting
material for these plantations. It is no mean achievement that with limited resources and
personnel involved in tree improvement programmes about 180 million seedlings of teak, sisso
and eucalypts being planted have been resourced from the seed production areas.
However, producing genetically improved superior seed
through tree improvement programmes requires knowledge of genetic variation in native species,
coupled with appropriate application of genetic principles, reproductive physiology and
seed-orchard management, to produce trees capable of better performance in a specified
biological zone. The goal is to understand and maintain an adequate genetic resource while
improving trees’ growth rate, disease resistance, stem, wood and fibre quality. These tree
improvement methodologies are prime requirements for improving land resource development and
essential for protecting the environment for a sustainable future. The potential impact that
genetic improvement of trees could have on land use types varies with the intensity of
management and with species and products required. ‘Green Revolution’, ‘White Revolution’ and
‘Blue Revolution are examples of ultimate results of genetics well managed. During the
formative stage of green revolution, there were more than 1,000 scientists working on one crop.
However, under tree improvement programmes in India, for so many species, the name of
geneticists working till date can be counted on tips.
In the past, genetic investigations of forest trees
have generally concentrated on morphometric, physiological, survival, growth initiation, height,
diameter growth, hardiness to environment stress, leaf, stem, fruit, wood and pest resistance
characters. The achievements have been tremendous with some genetic improvement programmes,
which are almost a century old, while in other cases results have just started pouring in.
If we look at some of the most impressive tree improvement programmes in India, hardly any
long term-plans, strategies or flow charts with committed funding can be traced. Most of the
programmes have been implemented in parts, whenever funding has been available, mostly from
the external sources. Still, results obtained by geneticists, with teak, silk-cotton tree,
eucalypt, sal, chir-pine, kadam, sandal and poplars (particularly cottonwood), etc., have been
commendable, where the oldest running tree improvement programme is of teak improvement at
Forest Research Institute, Dehradun (FRI).
Fast growing species of poplars, eucalypts, casurinas
have also been the cynosure for foresters and geneticists since they are considered the
alternative for providing large scale timber outside forests, where introductions, selections
and hybridizations have led to development of genetically improved clonal material. A lot of
work on the improvement of poplars in India has been done at Dr. Y. S. Parmar University of
Horticulture and Forestry, Nauni for the last 30 years, and therefore, by taking poplar as a
case history, we are highlighting, how strategies can help in achieving substantial gains
through tree improvement programmes.
Strategy of Tree Improvement
Most of the tree improvement programmes require a short
term as well as long term strategies which differ from exotic species to indigenous species.
Normally, we consider the introductions in arboreta, botanical gardens as the first stage of
improvement followed by the species trials, more relevant to the exotic species.
And provenance selection, individual tree selection, family selection, seed orchards -clonal,
-seedling, -stackling (VMG) and breeding programmes are more relevant to the indigenous
species. Therefore, if we look at these improvement programmes in India from time to time they
have all been carried out with regard to poplars also. The author is attempting to only
highlight some of the achievement and lacunas, since this article is only an attempt at
comprehension and part review of the work on poplars as a case example at what can be
achieved by developing your own strategies for improvement programmes, since our research
is more oriented or driven by the funding, along with some distinct social customs, rather
than by the need and necessity. The strategy adopted for the improvement has been highlighted
in Fig.1.
Fig 1. Strategy for poplar improvement adopted at the Dr. Y. S. Parmar University of Horticulture and Forestry
At the Dr. Y. S. Parmar University of Horticulture and
Forestry, Nauni breaders were guided into poplar research more by chance than by choice. It was
due to ban on wood harvesting from forests by match industry for matchstick. It led match-making
companies to look for alternative sources of wood and they found poplar to be an ideal material
for match sticks. Since in the Himalayas, amongst the five species of poplars, Populus
ciliata was the most widely distributed,M/S WIMCO Ltd. gave a grant to the university for
looking into the potential of this species for cultivation and plantations, since its
suitability for match was already known. Initially, the focus was on collection of clonal
material for short term benefit of selection and propagation, but later focus shifted on to
understanding the genecology of Populus ciliata and selection of provenances and plus trees
for immediate plantations in the fir zone. Later in the 1980s, the half sib-progeny trials,
disease resistance and hybridisation became a major issue. Then in the nineties, the field
studies and testing of the clones both in Populus ciliata and P. deltoides
took up most of the time with the latter species wresting the precedence from the former. By
that time, it had become quite evident that whereas the former species would be confined to
the Himalayas with limited plantation capabilities, the latter had the most potential, with
wider range and scope of plantations that is why, it had become one of the most important
agroforestry tree for intercropping interventions. Recently, the focus has been on the
characterisation of the clones on the basis of rooting behaviour for various planting situations.
Now a days attempts are being made to fingerprint the selected clones based on molecular
markers, both DNA and biochemical.
Introductions of Exotics
The tree improvement can be achieved by various means,
but the most important steps in tree improvement start with introductions or arboretum phase of
improvement followed by species or provenance trials, leading to individual tree selections,
progeny trials, seed orchards, breeding programmes, hybridization or mutation breeding. It has
often been observed that while many indigenous species can be planted, their productivity is
not comparable with some of the exotic species. Therefore, in initial stages of the poplar
improvement programme also a large number of exotic clones were imported from various countries
and tested for their suitability in India.
The FRI initiated the work on the introductions of
poplars, when 24 clones were introduced from England (Mathur and Sharma, 1983). The successful
attempts were made by the FRI and state forest departments of hill states to raise genetically
faster growing clones of poplars from time to time ever since 1950 (Khosla and Khurana, 1978;
Chaturvedi, 1982; Chaturvedi and Rawat, 1992 and 1994). Initially, ‘IC’ clones were considered
to be the best performers; however, these clones lost vigour and resistance to pest and
diseases by the 10th cycle of clonal cuttings. It was then realized that without a proper
poplar breeding programme of introduction of new clones the large-scale plantations being
undertaken may not remain viable (Chaturvedi and Rawat, 1994). However, a large number of
exotic species have also been introduced from time to time for testing, along with a large
number of clones. Currently, the species and clones available are presented in table 1.
Table 1. The species/clones of Populus available in India
Native species |
Exotic species |
Legitimate cultivars |
|
P.euphratica |
P.nigra cv.Italica |
P.'Canescens',P.'Eugenei' |
|
P.ciliata |
P.deltoides |
P.x euramericana cv.'I-214', 'I-455','I-67', 'I-67/55', 'I-145' |
|
P.alba |
P.yunnanensis |
P.'Lux', P.'Oxford' |
|
P.glauca |
P.trichocarpa |
P.'Regenere |
|
P.gamblei |
Ptremuloides |
P.'Robusta' |
|
P.suaveolens |
P.maximowiczii P.simonii P.grandidentata |
P.'Roxbury' P.'Serotina' More then 250 illegimate cultivars imported over the years |
The number of usable cultivars has been gradually
increasing, therefore, it became pertinent to identify them correctly and as precisely as
possible. In order to avoid confusion and to facilitate exchanges among users regardless
of whether or not such exchanges are on a commercial basis, the International Poplar Commission
(IPC) during its VII Session in 1953 decided to set up a Subcommittee of the Executive
Committee on Nomenclature and Registration with responsibility for investigating the best way
of establishing a register of poplar names by adapting the nomenclature used by the IPC to the
rules on nomenclature of cultivated plants. This job was all the more important as the IPC
has been designated as the official body for the registration of forest cultivars of the genus
Populus (International Code of Nomenclature of Cultivated Plants, Utrecht, 1958).
Some of these introductions have been quite successful
whereas; others could not take off from the introduction stage and were mostly lost after
nursery trials. Others, which were successful, have given good results like Populus x
euramericana ‘I-214’ and ‘I-455’ in the hills and P. deltoides ‘G-3’, ‘G-48’
in tarai and foot hills of many states. Sporadic avenue plantations of P. nigra ‘Italica’ in
Kashmir valley or as an ornamental tree are also sometimes seen. However, many clones of P.
deltoides have already revolutionized the wood production under agro-forestry and its wood
is largely being used in match and plywood industry. Populus ciliata,
at the same time has not been so commercialized, but is rather taken up for
plantations by the forest department on unstabilized slopes, freshly exposed soils
along the roads or as nurse crop for silver fir regeneration works. Therefore, in both these
species improvement programmes have been initiated with certain limitations.
In P. deltoides, the improvement has been restricted due to its being exotic
species, and P. ciliata due to its distribution only in the Himalayan region above an
elevation of 1,500 m and P. alba because of its very limited distribution in inner Himalaya.
Provenance Selections/Trials (Mass Selection)
Provenance collections and trials have also been
conducted in various species of poplars mostly with the Populus ciliata clones and
based on these some provenances have also been recommended for trials. Working with various
provenances of Populus ciliata, Khosla and Khurana (1979), Chauhan and Khurana (1992) and
Khurana et al. (1992) showed that variation pattern in different growth characters in different
provenances was controlled both by environmental and genetic factors. While Khosla and Khurana
(1982b) and Khurana and Khosla (1990) had established a correlation amongst various provenances,
which showed that every metre height gain directly corresponded with a centimeter in diameter
increase. The differences in growth rate in male and female trees were also not found to be
significant, but the growth rate in various ecological conditions varied significantly
(Khosla et al., 1980; Khurana and Khosla, 1982). Natural provenance variation studies with
P. alba showed good amount of genetic variation among stands requiring selections, as there
is a lot of variation in growth and rooting behaviour which could be utilized for the
plantations in the temperate arid zone (Ramesh and Khurana 2003, 2006 and 2007).
Individual Tree Selection (Plus Tree Selection)
Normally for individual tree selection, outstanding
trees with apparently superior growth characteristics based on scoring index method are
selected in the field in normally wild populations or plantations of exotics, and then based
upon their evaluation by geneticist and progeny trials are preserved as elite trees. Disease
resistance is another criteria for selection and in poplars selection of trees for growth,
form, resistance to melampsora rust and leaf and stem galling in Himalayan poplar have been
resorted to and selections were affected. A total of 63 plus trees in the Himalayas were
selected for Populus ciliata (Fig. 2), but a revisit after 10 years for seed collection
showed that only about 20 trees among these marked plus trees remained and rest had been cut
for timber and other purposes. So there is a strong dysgenic selection occurring in the Indian
forests where any marked plus tree is the first to go after a revisit of the area mainly because
it yields the best valued timber and mainly because of apathy of the protectors.
Fig. 2. Selected plus tree (on left) of P. ciliata with straight bole,
horizontal branching pattern, and >10 % gall formation on leaves and branches.
Progeny Trials
Seeds of the indigenous Populus ciliata were
collected from their native distribution zone in the Himalayas from the states of Jammu &
Kashmir, Himachal Pradesh, and Uttarakhand; whereas in the exotic species P. deltoides,
106 collections were collected from its native distribution zone in the Texas, Mississippi
and Brazos river basins and then imported through NBPGR. The collected open pollinated families
were raised in the mist chamber, hardened and planted in the nursery beds ands then cloned after
Stage-1 selections (Fig.3). From amongst 300,000 seedlings, 30,000 were transplanted in the
nursery, from amongst those about 300 were cloned and finally about 25 clones were used in the
all India Co-ordinated trials under the World Bank-FREE Project on Poplars at FRI, Dehradun
with good results. (Khurana et al., 1995, 1998; Farmer and Khurana, 1990).
Fig. 3. Selected best disease free ortet with straight columnar growth from the best
family and culled family with poor twisted stem form.
Amongst the progenies of these open pollinated seed
collections, selections have been made at nursery stage and clones put under clonal tests.
At many places, the plantations have also been raised from these indigenously selected clones,
which are under test (Chaturvedi and Rawat, 1992, 1994; Narkhede, 1995; Khurana et al., 1995 and
1998). The first stage of these trials have been conducted and evaluations showed some
outstanding results with new clones, which proved superior to many already tested clones
which have been proved through All India Co-ordinated Trials conducted through the aegis of
the FRI and M/S Wimco Seedlings Ltd. (Rawat et al., 2001).
The productivity levels of these new selected clones
at 7 years of age vary from 15-30 m-3 ha-1 yr-1 with various rooting categories, clones in
question and site conditions. Alternatively, the trees were found to be yielding wood at the
rate of anywhere between 0.5 to 1 m3 per tree amongst the selected clones (Fig.4). The
productivity levels with Australian clones from Punjab and Haryana are reported to be much
higher at 25 to 40 m-3 ha-1 yr-1 with some farmers reporting productivity levels of about
60 m-3 ha-1 yr-1 with intensive farming and supplementation of macro and micro nutrients under rigorous silvicultural practices.
Fig. 4. The range of variation in growth in different selected clones
of P. deltoids at age 7 in the field plantings.
Hybridization
Hybrid development in poplars is one of the prime
research occupations amongst poplar geneticists. Because of their fast growth rate, poplars
are most susceptible to various pest as compared to many other hardwood species. World over a
large amount of research effort is devoted to growth and disease resistance in poplars and
there are more than 200 hybrid cultivars of poplars being cultivated in different countries
(Viart, 1992).
Inter-specific hybridisation between Populus ciliata,
P. maximowiczii (three provenance collections), P. x euramericana ‘I-455’, P. deltoides,
P. yunnanensis, was carried out by Khurana (1989) and through hybrid embryo-rescue
for P. deltoides x P. ciliata by Khurana and Thakur (1995). Jha and Kumar (2000) also
raised inter-specific hybrids in different cultivars of P. deltoides, P. ciliata,
P. yunnanensis and P. x euramericana ‘Robusta’, including reciprocals and backcross. Earlier,
Chaturvedi and Rawat (1992 and 1994) had also reported on the inter-planted open pollinated hybrids
of P. ciliata and P. deltoides as well as on the inter-clonal hybrids of P. deltoides.
While both Jha and Kumar (2000) and Chaturvedi and Rawat (1992 and 1994) reported full
compatibility between P. deltoides and P. ciliata and their reciprocals, Khurana
and Bhanwara (1982) and Khosla and Thakur (1991) were able to get only one way cross between
them and where embryo rescue was adopted to get the hybrid seedlings.
Fig. 5. Size difference in the leaves of the seedlings of P. ciliata,
P. maximowiczii and F1 hybrids of P.ciliata x maximowiczii.
he most successful amongst inter-specific
crosses have been the crosses between P. ciliata x P. maximowiczii (Fig.5) and
P. euramericana ‘I-455’ x P. deltoides with very promising growth results in mid-hills
(Khurana and Thakur, 1995; Khurana et al. 1995). The hybrid clones which have been selected
for trials under various conditions based on their rooting pattern and behaviour are (see
Khurana, 1994; Bhrot and Khurana, 2001) - CM-3183, CM-3108, CM-3254, CM-3120 and CM-3213 having
category-A type of rooting pattern with a dominant vertical sinker root at the base for
interplanting conditions in agroforestry systems, clones CM-3226, CM-3246, CM-3122, CM-3239,
CM-3195 and CM-3287 showing category B of root pattern and clones CM-3160, CM-3203, CM-3162
and Hyb-I showing category-C of root pattern for block planting.The clones Hyb-III, CM-3167
and CM-3130 with category-D type of root pattern have been selected for loose soil conditions.
This germplasm has been evaluated against Alternaria
alternata and Melampsora species. The initial report on the resistant clones has been
published (Sharma et al. 1999), whereas the other studies on their growth performance and frost
hardiness are still continuing.
The success of naturally occurring inter-clonal hybrids
of P. deltoides had been more optimistic, which were labeled as Lal Kuan clones with
L – series. These had performed quite well under initial nursery and plantation trials at
various places (Chaturvedi and Rawat, 1992 and 1994).
Identification
A fundamental problem confronting poplar breeders
is the lack of genetic structure and accurate identification of clones. This knowledge is
essential for planning effective hybridization programmes, varietal control, protection and
registration, plant breeders right, day to day planning and handling of breeding stocks
(Rajora, 1989). The traditional method of poplar clone identification using morphological
and phenological criteria are difficult, time consuming and often subject to errors caused
by environmental mediation of the useful polygenic, morphological traits, personal biases and
subjectivity in observations. Phenotypic resemblance among commonly used clones is frequent.
The method adopted by International Poplar Commission (IPC), in cooperation with International
Union for Protection of New Varieties of Plants (UPOV) for identification, registration and
certification of poplar clones is based on a total of 64 traits for clonal description
(UPOV, 1981; Viart, 1992). Still accurate identification of the cultivars is not possible
using this approach because when any species is extensively crossed, the distinct barriers
of classification often broke down, and sometimes, it becomes difficult to differentiate
between different hybrids and clones. The electrophoretic separation of isozymes, in the
genetics of forest trees is one of the tools for evaluating the genetic structure of population
and identification of different closely resembling clones and cultivars.
The genomic organization of the various poplar species
(exotic and indigenous) in India has been done through DNA molecular markers to map out
distances (Rajagopal et al., 1999) and to find out the correlations between various species
for future breeding works. The genetic diversity amongst the collected half-sib families and
provenances of P. ciliata has also been done through RAPD markers to know about the genetic
distances of these collections (Rajagopal et al., 2000). Isozyme analysis has also been used to
identify the various hybrid plants of P. ciliata, P. maximowiczii and P. deltoides
(Handa et al., 2000; Khosla and Thakur, 1996, Chauhan et al., 2004) as well as to identify the
various selected clones in different species (Narkhede, 1995; Choudhury, 1995).
Archive Plantations (Germplasm Bank)
After the selected performing clones are used for
multiplication and trials, other clonal selections found to be different or now readily taken
for trials are kept in the archieve plantations for use in later breeding programmes, when
either the selected clones have lost their vigour or some of the other clones have become
non-productive, so that a breeder can fall back upon these clonal achieve for breeding and
development of new clones.
Refrences
Bhrot, N. P. and Khurana, D.K. 2001. Variability studies for some root characters in different clones of poplar. Indian Journal of Forestry, 24 (2): 150-152.
Chaturvedi, A.N. 1982. Poplar for farm forestry in Uttar Pradesh. Indian Forester, 107: 661-664.
Chaturvedi, A.N. and Rawat, B.S. 1992. Poplar tree
improvement programme. In: 19th Session of the International Poplar Commission, Zaragoza,
22-25 September 1992. Proceedings, vol.1: Poplar and willow growing in combination with
agriculture. Rome, FAO. pp. 687 – 693.
Chaturvedi, A.N. and Rawat, B.S. 1994. Poplar tree improvement programme. Indian Forester, 120: 97-104.
Chauhan, N.; Negi, M.S.; Sabharwal, V.; Khurana, D.K. and Lakshmikumaran, M. 2004. Screening interspecific hybrids of Populus (P. ciliata × maximowiczii) using AFLP markers. Theoretical and Applied Genetics, 108 (5): 951-956.
Chauhan, P.S. and Khurana, D. K. 1992. Growth performance of different provenances of Himalayan poplar. In: 19th Session of the International Poplar Commission, Zaragoza, 22-25 September 1992. Proceedings, vol.I: Poplar and willow growing in combination with agriculture. Rome, FAO. pp. 687-693.
Choudhury, P.R. 1995. Utilization of molecular markers for identification of Populus genotypes. M. Sc. thesis. Dr. Y.S. Parmar University of Horticulture and Forestry, Nauni.
Farmer, R.E., Jr. and Khurana, D.K 1990 Seed collection and storage of Populus deltoides. IDRC Tree Improvement/Farm Forestry Newsletter, 2: 6-8.
Handa, A.K.; Thakur, Sanjeev and Khurana, D. K. 2000. Isozyme banding in Populus ciliata x maximowiczii hybrids. Indian Journal of Forestry, 23: 75-77.
Jha, K. K. and Kumar, Y. 2000. Interspecific hybridization in poplars and initial performance of hybrids in tarai of Uttar Pradesh. Indian Journal of Forestry, 23: 1-11.
Khosla, P.K. and Khurana, D.K. 1978. Review of work on poplars in Himachal Pradesh with special reference to Himalayan poplar. Solan, Himachal Pradesh University. 34 p.
Khosla, P.K. and. Khurana, D.K 1979. Provenance delimitation and provenance trials in Populus ciliata Wall. ex Royle. In: Symposium on Silviculture, Management and Utilization of Polars, Srinagar, 15-18 October 1979.
Proceedings. Dehradun, Forerst Research Institute and Colleges. pp. 72-80.
Khosla, P.K. and Khurana, D.K. 1980. Provenance/site interaction on Populus ciliata Wall. ex Royle. Silvicultura, 30: 329-331.
Khosla, P.K and Khurana, D.K. 1982a. Evolution of genus Populus Linn. and systematic placement of P. ciliata Wall. ex Royle.Journal of Tree Science, 1: 81-87.
Khosla, P.K. and Khurana, D.K. 1982b. Concept of provenance testing and provenance trials in Populus ciliata Wall. ex Royle. In: Khosla, P.K. Ed.. Improvement of forest biomass. Solan, ISTS. pp.181-191.
Khosla, P. K. and Thakur, Sanjeev. 1991. In ovule-embryo culture of immature embryos of Populus ciliata x P. deltoides. Phytomorphology, 41: 267-269.
Khosla, P. K. and Thakur, Sanjeev. 1996. Identification of Populus hybrids using isozyme analysis. Indian Journal of Forestry, 19: 234-236.
Khosla, P.K.; Kaushal, P.C. and Khurana, D.K. 1980. Studies in Populus ciliata Wall. ex Royle II. Phenotypic variation in natural stands. Silvae Genetica, 29: 31-37.
Khurana, D.K.. 1989. Crossability patterns in Populus ciliata Wall. ex Royle. In: Meeting of the IUFRO Working Party, Hann, 2-6 October 1989. Recent developments in poplar selection and propagation techniques: Proceedings. IUFRO. pp. 159-166.
Khurana, D.K. 1985. Sexual dimorphism in Populus ciliata Wall. ex Royle. Journal of Tree Science, 4: 57-60.
Khurana, D.K. 1994. Preliminary selection of poplar genotypes for agroforestry systems. In: Singh, Panjab; Pathak, P.S. and Roy, M.M. Eds. Agroforestry systems for degraded lands Vol. I. Jhansi, RMSI. pp. 279-285.
Khurana, D.K. 2000. Reproductive biology of Populus ciliata Wall. ex Royle. In: Kohli, R.K.; Singh, H.P.; Vij, S.P.; Dhir, K.K.; Batish, D.R. and Khurana, D.K. Eds. Man and forests. DNAES. pp. 235-240.
Khurana, D.K. and Khosla, P.K. 1990. Provenance trials in Populus ciliata: Five year Results. In: Third Forestry Conference, Dehradun, 29 May to 1 June 1989. Papers Vol 2. Dehradun, Forest Research Institute. pp. 90(1-12).
Khurana, D.K. and Khosla, P.K. 1991. Populus ciliata: Its genecology and culture. (technical bulletin no. FBTI 4). Nauni, University of Horticulture and Forestry. 36 p.
Khurana, D.K. and Thakur, Sanjeev. 1995. Populus ciliata x maximowiczii: Preliminary report on a potential hybrid for mid-west Himalayan zone. Indian Forester, 121: 802-806.
Khurana, D.K.; Chauhan , S.K. and Mehta, Arun. 1992. Genotype and site interaction studies in some promising clones of exotic poplars in Himachal Pradesh. Journal of Tree Science, 11: 112 124.
Khurana, D.K.; Parkash, N.; Choudhury, P.R. and Narkhede, S. 1995. Poplar improvement in Himachal Pradesh. In: Khurana, D.K. Ed. Poplars in India: Recent research trends. Solan, IDRC-UHF.
Mathur, R.S. and Sharma, K.K 1983. Poplars in India. Indian Forester, 109: 591-631.
Narkhede, Satishkumar. 1995 Performance and evaluation of juvenile selections in poplars. Ph. D. thesis. Dr. Y.S. Parmar University of Horticulture and Forestry, Nauni.
Rajagopal, J.; Das, S.; Khurana, D.K. ; Srivastava, P.S. and Lakshmikumaran, M. 1999. Molecular characterization and distribution of a 145-bp tandem repeat family in the genus Populus. Genome, 42: 909-918
Rajgopal, J.; Bashyam, L.; Bhatia, S.; Khurana, D. K.; Srivastava, P. S. and Lakshmikumaran, M. 2000. Evaluation of genetic diversity in the Himalayan poplar using RAPD markers. Silvae Genetica, 49: 60-66.
Rajora, O.P. 1989. Identification of Populus deltoides Marsh. x P. nigra L. clones developed in North America with aid of allozymes. Euphytica, 43: 207-213.
Ramesh, K.R. and Khurana, D.K. 2003. Natural provenance variation in Populus alba Linn. from western Himalaya. Indian Forester, 129:1077-1084.
Ramesh, K.R. and Khurana, D.K. 2006. Rooting behaviour studies in Populus alba provenances for different agroforestry needs. Indian Forester, 132 (8): 989-1000.
Ramesh, K.R. and Khurana, D.K. 2007. Standardization of vegetative propagation techniques for rooting of Populus alba Linn. cuttings. Indian Forester, 133: 464-474.
Rawat, G.S.; Singh, N.B.; Gupta, R.K.; Singh, K. and Sharma, S.D. 2001. Clonal evaluation of poplar (Populus deltoids Bartr.) in Eastern Uttar Pradesh. I-Nursery testing. Indian Forester, 127 (1): 70-80.
Sharma, R.C.; Sharma, Sanjeev and Khurana, D. K. 1999. Assessment of poplar germplasm for resistance aginst Alternaria alternata causing leaf spot of poplars in Himachal Pradesh. Indian Forester, 125: 784-787.
International Union for Protection of New Varieties of Plants. 1981. Guidelines for the conduct of tests for distinctness, homogeneity and stability – Populus L. Geneva, International Union for Protection of New Varieties of Plants.
Viart, M. 1982. Usefulness of forest genetics to extension of poplar farming in India. Journal of Tree Science, 1: 8-16.
Viart, M.1992. Presentation du Catalogue International des cultivars de Peupliers. In: 19th Session of the International Poplar Commission. Poplar and Willow Growing in Combination with Agriculture, Zaragoza, 22-25 September 1992.Proceedings. Vol I. pp.49 – 105.
WIMCO Seedlings Ltd. 1997. Annual research report.Rudrapur, WIMCO Seedlings, Ltd.
DOMESTICATION AND GENETIC IMPROVEMENT OF EUCALYPTS IN NORTHERN INDIA
H.S. Ginwal and V.K. Sharma*
Forest Research Institute, Dehradun 248 006
Introduction
A
chievements in genetic improvement, in terms of yield of forest
tree species, have been less spectacular than that in agricultural
crops because of the very fact that forest tree species are more difficult to breed due to
their long generation times, prevalence of out breeding and the operational difficulties.
Further contrary to agricultural crop plants, which are mainly bred for seed, forest tree
species are bred for wood and are perennial. In trees many traits of economic value are not
expressed at their early stage of development and some times require several years for their
full expression. These problems have restricted the large scale, commercial breeding of forest
tree species to random mating of selected trees on very limited experimental scale only as in
seed orchards.
In the present scenario, when the demand of wood and
wood based products is increasing day by day, interest is being concentrated on growing short
rotation species to bridge the gap between the growing demand and inadequate supply of wood.
Eucalyptus species are among the most commercially utilized tree species of the world. However,
Eucalyptus find in India is highly inbred and the existing variability has been over exploited
through intensive selection of promising trees and their multiplication for commercial
plantation. Lack of sufficient genetic variability in existing populations of Eucalyptus is
one of the reasons for low productivity in India as compared to other countries because this
restricts the intensity of selection in populations with narrow genetic base. Eucalyptus
hybrid also known as ‘Mysore gum’, represents about half of the Eucalyptus planted in many
parts of India (Jacobs, 1981), which is believed to be derived from one small stand of the
early introductions in Nandi Hills (Proyor, 1966; Chaturvedi, 1976). In order to broaden
genetic base of Eucalyptus in India, and also to create more variability for further selection
and improvement, it is necessary to introduce and evaluate populations of wide geographical
distribution. The natural population collected from Australia and Papua New Guinea and seeds
collected from these populations could play a signification role when introduced in Indian
conditions. With this background, Australian populations of E. tereticornis are being evaluated
in a numbers of eco-climatic zones of India with the objective of identification of seed
sources/families/individuals, which are more productive in terms of wood volume and biomass
production. The superior seed sources could be used under afforestation programme or
outstanding individuals could be clonally multiplied on mass scale. If such plant material is
introduced in forestry sector a very high magnitude of genetic gain could be achieved in terms
of yield of wood per unit area per unit time.
Another approach for generating the variability could
be through hybridization either among existing species or between the introduced provenances.
In India, research work on tree breeding aspect in Eucalyptus is scattered and scanty except
some hybrids, which were developed at the Forest Research Institute, Dehradun. Beginning with t
he year 1965, and up till now more than a dozen different inter- species crosses have been
developed and a few combinations have displayed pronounced degree of hybrid vigour both in
respect of height and diameter growth the two major parameters contributing towards yield
and have produced, 3 to 5 folds more volume of wood than the parental controls. In the second
step multi locational clonal field evaluation trials were taken up after cloning desired genotypes using tissue culture techniques perfected at the institute as the tasks remain incomplete until high yielding types are brought to the field for plantation purposes.
In Eucalyptus, hybrids, which are usually planted in various plantations programme are generally F1 crosses between the wild and parents of different species. In recent years, inter-specific hybrids of Eucalyptus have come into commercial use and have the potential to be used in mass clonal propagation. In addition to exhibiting vigorous growth, the hybrids may bring together desirable characters from both parents
into a single individual (F1). Further, F1 hybrids produced from inter and intra provenance hybridization having potential for higher biomass production, could be utilized for forestry to improve the productivity per unit area per unit time.
If superior genotypes/clones of Eucalyptus are selected carefully from the natural or breeding populations and clonally propagated at large scale using already available clonal technique, then the ramets from these selected clones could be used directly for raising commercial plantations to ensure that the superior growth characteristics of the clone are retained. Thus the vegetative propagation of Eucalyptus would ensure improvement in the yield and quality, shortening of the rotation period and overcoming some of the biological problems hindering in raising Eucalyptus plantations on stress sites. Many countries all over the world have already initiated projects on producing high quality clones of Eucalyptus. However, information on realized gains from Eucalyptus improvement programmes in India is understandably still scarce.
By combining both the approaches i.e. introduction of outstanding provenances and hybrid populations developed through breeding can be used for selection of superior genotypes and subsequently, propagated clonally on mass scale at low cost using the already available technique for raising commercial plantations, which will ensure increase in productivity.
Eucalyptus under Plantations
Species of Eucalyptus are the most common constituent
of forest plantations in Tropical Asia and the Pacific. The area of Eucalyptus plantations in
Tropical Asia and the Pacific was 5.2 million ha in 1990, (Ball, 1995). In India alone where a
total of 4.82 million ha of Eucalyptus has been reported (Ball, 1995). Most of these plantations
have been planted for non-industrial outputs. In contrast, the area of pines (1990) was
reported to 1.25 million ha, teak was 2.03 million ha. In considering the non-forest
plantations, the area of rubber in Asia in 1990 was estimated as 7 million ha, of coconut as 4 million ha and of oil palms just over 2 million ha (Pandey, 1992). None of the considerable areas of other species in forest plantations or of non forest plantations, have caused the furor evoked by the Eucalyptus (Ball, 1995).
Introduction and Evaluation of Germplasm
Eucalyptus camaldulensis
Kumarvelu et al. (1995) reported better performance
of E. camaldulensis provenances over E. tereticornis in southern part of India. They found four
promising provenances of E. camaldulensis with respect to growth and survival viz., Katherine,
Richmond, Gibu River and Gilbert River. Studies conducted by Rao (1984), Davidson and Das
(1985) and Moura (1986) revealed promising performance of Petford (Queensland) provenance
in India, Bangladesh and Brazil.
Ginwal et al. (2004) studied six seed sources from Australia viz., Laura River, Emu Creek, Degrey River, Wiluna, Kennedy River and Morehead River from nursery stage (three months) to field performance (four years) at Seothi (300 N Lat., 760 E Long. and 250 m Altitude) Haryana, a semi-arid region of India during 2001 - 2003. At 4 years, significant differences among the seed sources (P<0.05) were observed for height and field survival. The two seed sources viz., Emu Creek Petford (QLD) and Laura River (QLD) ranked first and second for height and survival at this age. Results indicated that genetic differences existed between the sources of E. camaldulensis. The differences even reflected in phenotypic and genotypic coefficient of variability. High heritability was reported for height and clear bole length in comparison to collar diameter, number of branches and survival. The relative performance of these provenances was consistent throughout the period of observation. Laura River (QLD) and Emu Creek Petford (QLD) were recommended for potential source for plantation
programme under semi-arid conditions.
Eucalyptus tereticornis
Germplasm of E. tereticornis from almost entire
range of distribution from Australia was introduced in India in the form of provenance cum
progeny trials (Ginwal et al., 2004) at different sites viz., FRI Campus (Uttarakhand),
Chiryanpur (Uttarakhand), Manakpur (Haryana) and Midnapore (West Bengal). Thirteen provenances
representing 91 families from Australia and Papua New Guinea (PNG) viz., Oro Bay to Emo (PNG),
Sirinumu Sogeri Plat (PNG), Warwick (QLD), Yurammie (SF, NSW), Buckenbowra (SF, NSW), Selection
Flat SF559 (NSW), Credition (SF, QLD), Cardwell (QLD), Mitchell River MT Molloy (QLD), Mill
Stream Archer Creek (QLD), Helenvale (QLD), Walsh River (QLD) and Burdekin River (QLD) were
evaluated from nursery stage to field performance (age 4 years). As a local seed source open
pollinated seeds collected from interspecific Eucalyptus hybrid trees FRI-4, FRI-5 and Mysore
gum (Eucalyptus teretirornis) were used as check control. Significant differences
between the provenances and families at age four years were observed for height, clear stem
length, diameter and field survival. Significant provenance x site interaction was observed for
height. In general, North Queensland provenances performed better and in particular two
provenances viz., Walsh River (QLD) and Burdekin River (QLD) toped the ranking at this age.
Results indicated that significant genetic differences existed between the families and
provenances of E. tereticornis. The growth traits were inter-correlated with each other.
Geographic clonal variation pattern was observed for some of the growth traits viz., height,
clear stem height and collar diameter. The relative performance of the provenances was fairly
consistent throughout test sites.
Hybridization
The importance of hybrid in afforestation programmes is well documented and considerable effort has been
made for the production of artificial hybrids. In addition, studies on natural and artificial
hybrids yield information on phylogenetic relationship of forest trees (Mergen et al., 1966).
Based on the crossability pattern in the genus Eucalyptus, several interspecific hybrid
combinations involving different parent species were tried and F1 hybrids produced (Venkatesh
and Sharma, 1977a, 1977b, 1977c, 1978,1979 and 1980, Kapoor and Sharma, 1983,1984a, 1984b;
Bisht et al, 1999). The information on various hybrids developed or natural hybrids identified
on the basis of morphological genetic markers is provided in Table 1.
Table 1. Interspecific controlled and natural hybrids developed at FRI, Dehradun
Accession number |
Parental combinations |
Year |
|
FRI-2A |
E.tereticornis(20)XE.camaldulensis(2) (Northern form) |
1966 |
|
FRI-3A |
E.tereticornis(19)XE.camaldulensis(2) |
1968 |
|
FRI-4A |
E.tereticornis(20)XE.camaldulensis(2) |
1970 |
|
FRI-5N |
E.camaldulensis XE.tereticornis |
1970 |
|
FRI-6A |
E.tereticornis(14)XE grandis(6) |
1971 |
|
FRI-7A |
E.tereticornis(19)XE grandis(6) |
1973 |
|
FRI-8a |
E.tereticornis(16)XE grandis(6) |
1974 |
|
FRI-9A |
E.tereticornis(17)XE grandis(6) |
1974 |
|
FRI-10N |
Putative hybrid(natural, reciprocal of FRI-6) |
1974 |
|
FRI-11A |
Lost Combination |
|
|
FRI-12A |
Lost combination |
|
|
FRI-13A |
(E.camaldulensis XE.tereticornis) XE grandis |
1976 |
|
FRI-14N |
E.torelliana XE.citriodora |
1976 |
|
FRI-15N |
E.citriodora XE.torelliana |
1976 |
|
FRI-16A |
E.tereticornis XE.camaldulensis(Southern form) |
1997 |
N.B. Numerals within the parentheses denote the tree numbers.
A-Artificially cross-pollinated, N-Naturally pollinated.
Evaluation of F1 Hybrids
1. Growth performance
(a) F1 hybrids E. tereticornis x E. camaldulensis (FRI-4) and E. camaldulensis x E. tereticornis (FRI-5)
In a pilot field trial established in 1972-73 at
Dehradun these hybrids have displayed hybrid vigour in respect of height, diameter and
standing tree volume. An assessment made at age 4 years has shown that F1 hybrids dramatically
excelled parental control by 2.7 folds (Table 2), inter se comparison of the two hybrids has
shown that FRI-5 is significantly superior in growth parameters than FRI-4.
(b) F1 hybrids E. tereticornis x E. grandis (FRI-6) and E. grandis x E. tereticornis (FRI-10)
The F1 hybrid between E. tereticornis and E. grandis
was found to be intermediate to parents species. These interspecific hybrids though
intermediate to parental species in more than half of the total number of contrasting
characters studied (Venkatesh and Sharma, 1979) was important as it involved E. grandis
and E. tereticornis, the former showed faster growth rates, good stem form, provides quality
pulp and prefers high rain fed areas while, the latter is drought tolerant. It is,
therefore, very likely that hybrids might be suited for intermediary zones (hybrids habitat).
(c) F1 hybrids of E. torelliana x E. citriodora. (FRI-14) and E. citriodora x E. torelliana (FRI-15)
These F1 hybrids have shown a very high degree of
sustained hybrid vigour in respect of height and diameter, two major parameters contributing
towards wood yield. An assessment made at age 10 year has revealed that hybrids were superior
to parent species viz., E. citriodora by 4.5 fold with regard to volume of wood produced
(Table 3). These may be used for improving productivity of wood per unit area and per unit
time. Additionally, these have also shown resistance against two fungi viz.,
Cylindrocladium quinqueseptatum and Corticium salmonicolor as the female parent is
resistant to these both the fungi .
2. Evaluation of F1 hybrids and F2 and F3 segregants for wood properties
(a) Specific gravity
(i) F1 hybrids
Specific gravity of wood is an important criterion and given weightage in selection of plus trees which are aimed to bring improvement in wood properties
and pulping qualities. This particular trait is codependent on various other parameters like fibre length, fibre width, fibre wall thickness and lumen diameter. Studies carried out on specific gravity of wood of different species have shown high heritability and the trait is under strong genetical control (Zobel, 1961).
Table 2. Mean, significance and bar diagram for height and diameter at age 4
|
character |
Mean
1
2
3
4
5
6
7
significance |
Bar diagram |
|
Height(m) |
8.27
8.94
7.77
6.73
6.32
6.47
5.63
*** |
2 1 3 4 6 5 7 |
|
DBH(m) |
638.5
776.8
610.7
490.3
449.9
431.0
336.5
*** |
2 1 3 4 5 6 7 |
Height(m) (Myscore Gun glass) |
77.7
6.73
6.32
** |
3 4 5 |
Height(m) (Myscore Gun glass) |
610.7
490.3
449.9
*** |
3 4 5 |
***Significant at 0.1%level;
**Significant at 1% level
Hybrid Class
1.FRI-4
2.FRI-5
Mysore Gun Class
3. Good parant progenirs
4. Average parant progenirs
5. Poor parant progenirs
Parantal Class
6. E.camaldulensis
7. E.tereticornis
(Source:Venkatesh and Sharma, 1977)
Table 3. Per cent superiority of E. citriodora and E. torelliana hybrids over parents at 10 years
|
Percent superiority over |
Height |
Dbh |
Volume |
|
E.citriodora |
25.4 |
92.3 |
464.2 |
|
E.torelliana |
56.8 |
12.8 |
99.4 |
|
Mid-parent |
39.4 |
42.2 |
178.9 |
Because of its effect on quality and yield and its
high heritability, specific gravity has become of major interest in most tree improvement
programmes, irrespective of the objective of producing fibre or solid wood products
(Zobel et al., 1978).
Wood properties of F1 reciprocal hybrids of
E. citriodora and E. torelliana were
studied at FRI, Dehradun at the age of seven years by taking cores using increment borer.
The results have shown (Table 4) that specific gravity of F1 hybrids was in the range
of 0.5619 (E. torelliana x E. citriodora) and 0.6161 (E. citriodora x E. torelliana),
where as the specific gravity of parent species was 0.6599 (E. torelliana) and 0.9253
(E. citriodora). The F1 hybrids showed intermediate specific gravity of wood as compared
to parents (Kapoor, 1992). Pryor et al. (1956), reported that wood properties of most
Eucalyptus hybridswere intermediate or same as the parents, and seemed to be under
multiple factor control. There is a common agreement that several critical pulping and paper properties will decline as basic density (specific gravity) rises.
Table 4. Wood properties of Eucalyptus F1 hybrid E. citriodora, E. torelliana at age of 6.5 years
|
S.no. |
Material |
Specific Gravity Gravity |
Fiber Length(mu) |
Wall thickness(mu) |
Lumen Diameter(mu) |
|
1 |
F1 E.citriodora |
0.6161 |
1291.4 |
4.70 |
6.55 |
|
2 |
F1 E.torelliana X E.citriodora |
0.5619 |
1168.0 |
4.15 |
10.65 |
|
3 |
E.citriodora |
0.9253 |
970.8 |
6.66 |
8.15 |
|
4 |
E.torelliana |
0.6599 |
1069.8 |
5.46 |
8.91 |
(Source: Kapoor, 1992)
(ii) F2 and F3 segregants
The second and third segrigating generations of E. citriodora and E. torelliana were also studied
for wood properties (Verma et al., 2001). The specific gravity of wood for E. torelliana, E. citriodora, F2 E. citriodora x E. torelliana, F2 E. torelliana x E. citriodora and F3 E. citriodora x E. torelliana
was found to be 0.6521, 0.8535, 0.6328, 0.5697 and 0.5604, respectively. Highest specific
gravity of wood was exhibited by E. citriodora and the lowest values for the same were
observed in segregating populations F3. The F2 populations of reciprocal hybrids
(E. citriodora x E. torelliana) showed intermediary values as compared to parental
progenies. The statistical analysis of data has shown that the differences between the
progenies were highly significant at 0.1 per cent level. (Table 5 and 6).
Table 5. Mean values along with range (in parentheses) for specific gravity of wood
|
Charaacter |
Segments of increment core |
E.torelliana |
E.citriodora |
F2E.citriodora xE.torelliana |
F2E.torelliana x E.citriodora |
F3E.citriodora x E.torelliana |
|
|
Outer |
0.6828 (0.6573-0.7166) |
0.8840 (0.8297-0.9200) |
0.6644 (0.6324-0.6991) |
0.6076 (0.5575-0.6619) |
0.5943 (0.5357-0.6560) |
|
Sprcial Gravity |
Middle |
0.4688 (0.6265-6705) |
0.8557 (0.8325-0.8848) |
0.6366 (0.6177-0.6528) |
0.5672 (0.5279-0.5987) |
0.5569 (0.5062-0.6289) |
|
|
Inner |
0.6235 (0.5800-0.6465) |
0.8208 (0.7398-0.8749) |
0.5972 (0.4574-0.6513) |
0.5341 (0.5136-0.5580) |
0.5303 (0.5055-0.6257) |
(Source: Verma,S.K. et al., 2001)
Table 6. Results of statistical analysis of specific gravity
|
Charaacter |
Comparison between parantal and segerating F2 F3 progenies |
Bar diagram of mean values |
C.D |
Significance level |
Specific Gravity |
Treatment |
B
A
C
D
E
|
0.029 7 |
*** |
|
|
|
0.8535
0.5617
0.6328
0.5697
0.5604
|
|
|
|
|
Segment |
Outer
Middle
Inner
|
0.018 2 |
*** |
|
|
|
0.6866
0.6530
0.6212
|
|
|
A-E. torelliana B-E citriodora C-F2 E. citriodora x E. torelliana D-F2 E. torellina x E. citriodora E-F3
E. citriodora x E. torelliana
(Source: Verma, S.K. et al., 2001)
(b) Fibre Studies
(i) F1 Hybrids
The F1 reciprocal hybrids (E. citriodora and
E. torelliana) had longer fibre length and less wall thickness compared to parents (Table 4).
The F1 hybrids of E. citriodora x E. torelliana and E. torelliana x E. citriodora have shown l
ongest fibers length (1291.4 µm) and widest lumen diameter (10.65 µm) as compared to parent
species. So far as the wall thickness is concerned, both the reciprocal hybrids have registered
the lowest value as compared to parent species which is of interest from pulping and paper
making point of view.
(ii) F2 and F3 segregants
Fibre studies carried out on F2 and F3 generations
have shown some plants which recorded higher values for fibre length, fibre width and
lowest value for lumen diameter as compared to parent species (Verma, 1998).
In F2 generation of E. citriodora and E. torelliana the highest values recorded for
fibre length, fibre width were 1245.32 and 18.43µm, respectively while in F3 E. citriodora
x E. torelliana the lowest value recorded for fibre wall thickness was 4.60 µm. However,
maximum lumen diameter was recorded in F3 E. citriodora x E. torelliana. All these
parameters, besides others like kappa number and others are of great significance, which
contribute a lot to the quality of paper. Longer fibre will presumably lead to increase in
higher tear index. It also affects the physical properties of the sheet such as the strength
and rigidity, especially tearing strength which decreases with decrease fibre length.
Fibre width and fibre wall thickness are also important
parameters, which determine the quality of paper. Thin walled fibres produce a dense, more
evenly formed sheets in contrast to thick walled fibres which remain stiff and give bulky
(large air spaces), coarse textured paper (Hill, 1984).
Since a wide spectrum of variation has been
observed for specific gravity in individual trees F2 and F3 generations, becomes a source
for desired recombinants for different end uses.
The variations thus obtained are indicative
of the quality gradation that can be exploited through vegetative propagation. If clonally
propagated plantations are raised and tested for their pulping quality, a high magnitude of
genetic gain may be achieved.
Macropropagation
Recent advances in the production of Eucalyptus cuttings will facilitate the cloning of genetically improved or otherwise desirable individuals on a commercial
scale. Intensive phenotypic selection is made either in plantations or in populations created by
open or controlled pollination. The selected individuals are cloned and tested, and their
rooting ability is noted. The mass production of cuttings is generally done from adventitious
or epicormic shoots, the best results, both quantitatively and qualitatively are achieved when
plants from 3-5 years of age are used. With present technology, it is possible to produce up to
600 rooted plants from one single individual every year (Chaperon, 1978; Chaperon and Quillet,
1978). In 1976, 300 ha of cuttings of E. alba x E. urophylla and E. tereticornis x E. saligna
were planted in Congo. It was for the first time when Eucalyptus cuttings were planted on a
semi- industrial
scale (Chaperon, 1978).
Generally, a mixture of hybrids or clones is used for
commercial plantations. Excellent gains in productivity have been achieved through a
combination of breeding and vegetative propagation strategies in respect of various species
of Eucalyptus, e.g. cloning of natural and control pollinated inter-specific hybrids in Congo
and Brazil. The selection programme in Congo had identified 174 superior genotypes of
E. alba x E. urophylla and 256 of E. tereticornis x E. saligna using tree
height, form, productivity per ha, rooting ability and pulping qualities as the criteria for
selection. By the end of 1984, the area under clonal Eucalyptus plantations was about 20,000
ha with mean annual increments after 6 years averaged to 35 m3/ha/yr compared to 20-25 m3/ha/yr
of selected provenances and about 12 m3/ha/yr of unselected seedlots (Leakey, 1987).
Rooting of cuttings
Rooting of juvenile cuttings has great potential in
improving the forest productivity. Leafy cuttings taken from very young seedlings or shoots
developed from lignotubers of most Eucalyptus species can easily be rooted in sand with
bottom heat in about 2 to 3 weeks (Pryor and Willing, 1963). However, the capacity to root by
the cuttings declines very rapidly as the plants become older. In most of the species it becomes non -
existent when they have passed the fifteen leaf pairs stage.
Failure to root, in shoot cuttings from mature eucalypt
trees is ascribed to a rooting inhibitor in adult tissue (Patton et al., 1970). Coppicing,
however, restores physiological juvenility (Franclet, 1983) and cuttings from rejuvenated
coppice shoots, root very easily. This method has been used on a large scale in Brazil with
E. grandis (Campinhos and Ikemori, 1980), with selected hybrids of E. alba x E. urophylla and
in Southern France with selected hybrids of E. gunnii and E. delegatensis (Chaperon, 1983).
For species, which do not coppice readily such as E. deqlupta, application of IAA and IBA
promotes profuse coppicing on cut stumps (Venkatesh, 1986; Davidson, 1977), which then can be
used for rooting purposes.
Briefly, the Congo-Brazilian method consists of
selecting outstanding large, straight tress, felling them and allowing their stumps to coppice.
The coppice shoots are collected approximately 6 weeks after felling and put for rooting under
mist condition with hormone application root profusely. The shoots, measuring about 40 cm in
length are each subdivided into 2 to 3 cuttings per shot, each bearing two leaf pairs. Leaves
are cut half to check transpiration. The cuttings are immersed in Benlate solution for 15
minutes prior to treatment with a commercial root-promoting hormone, Seradix No. 3. Subsequently,
the cuttings are placed in charcoal fines in planter flats, which are kept on racks in
greenhouse. Continuous mist is applied for about 6 months. Roots appear first within four weeks
of planting. In the fifth week, the rooted cuttings are hardened prior to their transfer to
nursery. This is done by ceasing to spray at intervals of 90 minutes at a time. Cuttings, which
have not rooted or have very weak root system, fail to survive during this period. Roots
produced through the bottom of the trays are pruned prior to nursery planting. By this method
rooting in about 49.5 per cent of the shoots is achieved, out of which approximately 41.3 per
cent are plantable. Variations in this method are mainly due to either (a) application of
hormone solution instead of commercial hormone or (b) application of hormone synergids in
certain cases instead of hormone solutions or both.
In India, work on clonal propagation of Eucalyptus was
taken up by different organizations/institutes viz., ITC Bhadhrachalam Paper Board Ltd, Andhra
Pradesh, Tata Energy Research Institute (TERI) and institutes under the Indian Council of
Forestry Research and Education, Dehradun. ITC Bhadhrachalam Paper Board Limited has used the
technology for production of clonal material on commercial scale using the selected clones.
More than 200 plus trees, selected based on desirable phenotypic characters, have been cloned
and significantly large differences in growth rates and disease resistance capacity of different
clones have been noticed in the field trials (Piare Lal, 1994). Mean annual increment of
16 m3/ha/yr at 3 years age has been recorded by some of these clones under rainfed conditions
productivity is expected to rise by the 7th year to 20-25 m3/ha/yr. This will mean 50 per cent
improvement in productivity compared to plantations based on improved seed of seed orchard
origin and nearly four fold increase in yield over Eucalyptus plantations raised from
unimproved seed (Piare Lal, 1994). While ICFRE institutes under Forestry Research, Education
and Extension Project established vegetative multiplication gardens (VMG) of various Eucalyptus
species by assembling hedges of selected candidate plus trees (CPTs). The hedges are
maintained in hedge garden and produce juvenile shoot cuttings, which give 40-70 per cent per rooting
under mist condition and controlled temperature. Similarly, the plantlets developed through
tissue culture of F1 interspecific hybrids were used to establish hedge garden and subsequently
used for clonal propagation (Uniyal, 2002).
Rooting of leafy cuttings of Eucalyptus
species/hybrids have been successfully achieved (Gurumurthi et. al., 1988; Vakshasya and Rawat,
1986; Chandra et. al., 1988). The advances made in the techniques of vegetative propagation of Eucalyptus are revolutionary for enhanced productivity using a combination of traditional tree breeding and vegetative propagation. Through this technique, volume production of some Eucalyptus species can easily be increased to more than double in less than ten years.
Micropropagation
The primary application of tissue culture in forest trees is to multiply desirable genotypes of such species/hybrids, which are hard to root by the conventional methods. Propagation of more than a dozen species/hybrids of Eucalyptus adopting tissue culture technique
(micropropagation) has been successfully tried from explants taken from juvenile as well as
mature trees. At FRI, Dehradun protocols for tissue culture of candidate plus trees (CPTs)
of Eucalyptus tereticornis (Bisht et al., 2000), promising hybrids of Eucalyptus viz.
E. tereticornis x E. camaldulensis, (Chauhan et al., 1996), E. camaldulensis x E. tereticornis
(Bisht et al., 2000) and reciprocal hybrids of E. citriodora and E. torelliana,
(Kapoor and Chauhan, 1992, Sharma et al., 2002; Bisht et al., 2002) and FRI 16
E. tereticornis x E. camaldulensis, southern form (Bisht et al., 1999)
have been developed. Plants thus produced were transferred from in vitro to in vivo
environment for studies on hardening and subsequently, a field trial was laid out to
study their relative growth performance with other clones developed by ITC Bhadhrachalam.
By application of this technique, rapid genetic
improvement with higher yield of wood both in terms of qualitative and quantitative traits
may be achieved under commercial management, if they are applied judiciously.
Information on realized gains from eucalypt improvement
programmes is understandably still scarce. One of the basic assumptions in most on going
eucalypt improvement programmes is that eucalypts are randomly out breeding. If selfing and
non-random mating are common, estimates of additive genetic variance and consequently, of
predicted gains from mass selection will be over optimistic (Namkoong, 1966). If the
assumptions made prove correct, remarkable gains from traditional tree improvement methods
are likely to be achieved in Eucalyptus in short span of time, owing to their nature of
precocious flowering and short rotation crop.
References
Ball, J.B. 1995. Development of Eucalyptus plantations - an overview. In: Regional Expert Consultation on Eucalyptus, Bangkok, 4-8 October 1993. Proceedings. Vol .I. pp.15-27
Bisht, Prabha; Sharma, V.K.; Joshi, Ila and Kapoor, M.L. 1999. Micropropagation of newly produced F1 hybrid of Eucalyptus (E. tereticornis Sm x E. camaldulensis Dehn. Southern form). Silvae Genetica, 48: 104-108
Bisht, Prabha: Joshi, Ila; Chauhan, J.M.S and Sharma,V.K. 2000. In vitro clonal propagation of mature Eucalyptus F1 hybrids FRI-5 (E. camaldulensis Dehn x E. tereticornis Sm.) Indian Journal of Forestry, 23 (1): 28-32.
Bisht, Prabha; Joshi, Ila; Chauhan, J.M.S.; Sharma, S.K. and Bagchi, S.K. 2000. Micropropagation of 23- year- old candidate plus tree of Eucalyptus tereticornis Sm. Indian Journal of Forestry, 23 (2): 149-154.
Bisht, Prabha; Sharma, V.K. and Uniyal, D.P. 2002. In vitro clonal propagation of mature Eualyptus F1 hybrid E. citriodora Hook. X E. torelliana F.V. Muell. Indian Journal of Forestry, 25(3-4): 481-485.
Chandra, J.P.; Reddi, O.; Umesh Kumar and Rai, R.S.V. 1988. Rooted cuttings for Mysore gum cultivation. Proc. Consultation Meeting on Strategies for Forest Genetics and Tree Improvement Resources in India, Coimbatore, 26-27 Sept.1988. Proceedings. Coimbatore, IFGTB.
Chauhan, J.M.S.; Bisht, Prabha; Kapoor, M.L. and Rawat, M.S. 1996. In vitro clonal propagation of Eucalyptus hybrid FRI-4 (E. tereticornis Sm x E. camaldulensis Dehn.). Annals of Forestry, 4 (2): 186-191.
Chaperon, H. 1978. Amelioration genetique des Eucalyptus hybrids au Congo Brazzaville. In: Third World Consultation on Forest Tree Breeding, Canberra, 1978. Proceedings vol. 2. Canberra, CSIRO. pp. 579-591.
Chaperon, H. 1983. Selection individuele et clonage d’ Eucalyptus. In: IUFRO Collque, Bordeaux, September 1983. Proceedings. Paris, AFOCEL. pp. 535-558.
Chaperon, H and Quillet, G. 1978 Resultats des travaux sur le bouturage des Eucalyptus au Congo Brazzaville. In: Third World Consultation on Forest Tree Breeding, Canberra. 1978. Proceedings vol 2. Canberra, CSIRO.
Ginwal, H.S.; Kumar, P.; Sharma, V.K.; Mandal, A.K. and Harwood, C.E. 2004. Genetic variability and early growth performance of Eucalyptus tereticornis Sm. in provenance cum progeny trials in India. Silvae Genetica, 53(4-5): 148-153.
Ginwal, H.S.; Pradip Kumar; Sharma, V.K. and Mandal, A.K. 2004. Seed source variation in growth performance of Eucalyptus camaldulensis Dehnh. of Australian origin in India. Silvae Genetica, 53 (4): 182-186.
Gurumurthi, K.; Bhandari, H.C.S. and Negi, D.S. 1988. Vegetative propagation of Eucalyptus. Indian Forester, 114: 78-83.
Hill, W.E. 1984. Wood quality and utilization. In: Hillis, W.E. and Brown, A.G. Eds. Eucalypts for wood production, 2nd ed. Canberra, CSIRO. pp. 259-289.
Kapoor, M.L. and Sharma, V.K. 1983. Studies on the effect of hybridization between E.citriodora and E. torelliana. Indian Forester, 109: 891-900.
Kapoor, M.L. and Sharma,V.K. 1984a. Hybrids between E. citriodora Hook and E. torelliana Fv Muell. in India. Silvae Genetica, 33: 42-46.
Kapoor, M.L. and Sharma, V.K.1984b. Potentiality of genetic manipulation for increasing biomass production in Eucalyptus. Indian Forester, 110(8): 814-819.
Kapoor, M.L. 1992. Potential of tree improvement and tissue culture for paper and alike industries. IPPTA Journal, 4 (1): 1-6.
Kapoor, M.L. and Chauhan, J.M.S. 1992. In vitro clonal propagation of mature Eucalyptus F1 hybrid (E. torelliana F. V.Muell x E. citriodora Hook). Silvae Genetica, 41(6): 305-307.
Mergen, F.; Lester, D. T.; Furnival, G. M. and Burley, J. 1966. Discriminant analysis of Eucalyptus cinerea x Eucalyptus maculosa hybrids. Silvae Genetica, 15: 148-154.
Paton, D.M. Willing, R.R.; Nicholls, W. and L.D. Pryor. (1970). Rooting of stem cuttings of Eucalyptus a rooting inhibitor in adult tissue. Australian Journal of Botany, 18: 175-183.
Piare Lal, 1994. Economics and mass multiplication of forest trees. Indian Forester, 120: 85-96.
Pryor, L.D.; Chattaway, M. M. and Kloot, N.H. 1956. The inheritance of wood and bark characters in Eucalyptus. Australian Journal of Botany, 4 (3): 216-239.
Pryor, L.D. and Willing, R.R. 1963. The vegetative propagation of Eucalyptus an account of progress. Australian Forestry, 27: 52-62
Uniyal, D.P. 2002. Planting stock improvement programme (FREEP): Final report Dehradun, Indian Council of Forestry Research and Education. 89p.
Vakshahya, R.K. and Rawat, M.S. 1984. Somatic multiplication in Eucalyptus camaldulensis through leafy cuttings. Indian Forester, 110: 56-60.
Venkatesh, C.S. 1986. Problems and prospects of cloning Eucalyptus. In: National Seminar on Eucalyptus in Indian Forestry: Past, Present and Future, Peechi, 30-31 January 1984. Eucalypts in India: Past, present and future. Peechi, Forest Research Institute. pp. 314-317
Venkatesh, C.S. and Sharma, V.K. 1977a. Differential heterosis in reciprocal interspecific crosses of Eucalyptus camaldulensis and E. tereticornis. In: Third World Consultation on Forest Tree Breeding, Canberra, 21-26 March 1977. Proceedings Vol 2. Canberra, CSIRO. pp. 676-682.
Venkatesh, C.S. and Sharma, V.K. 1977b. Rapid growth rate and higher yield potential of heterotic Eucalyptus species hybrids FRI – 4 and FRI-5. Indian Forester, 103(12): 795-802.
Venkatesh, C.S. and Sharma, V.K. 1977c. Hybrid vigour in controlled inter-specific crosses of Eucalyptus tereticornis x E. camaldulensis. Silvae Genetica, 26: 121-124.
Venkatesh, C.S. and Sharma,V.K. 1978. Comparative morphology of parents and reciprocal inter-specific hybrids between Eucalyptus tereticornis and Eucalyptus camaldulensis. Phytomorphology, 28: 345-350.
Venkatesh, C.S. and Sharma, V.K. 1979. Comparison of a Eucalyptus tereticornis x E. grandis controlled hybrid with E. grandis x E. tereticornis putative natural hybrid. Silvae Genetica, 28:127-131.
Venkatesh, C.S. and Sharma, V.K. 1980. An artificial inter- specific Eucalyptus hybrid (E camaldulensis Dehn x E. tereticornis Sm.) x E. grandis Hill ex Maiden. Euphytica, 29(2): 451-458.
Verma, S.K. 1998. Morphogenetical studies on segregating populations of Eucalyptus citriodora Hook. X Eucalyptus torelliana F.v. Muell. hybrid. Ph. D. thesis, Forest Research Institute, Dehradun,
Verma, S.K.; Sharma, V.K. and Bagchi, S.K. 2001. Variation in specific gravity of wood in segregating F2 and F3 populations of E. citrodora Hook. x E. torelliana F.V. Mull. hybrids. Indian Forester, 127(4): 450-456.
Zobel, B.J. 1961. Inheritance of wood properties in conifers. Silvae Genetica, 10(3): 65-70.
Zobel, B.J.; Jett, J.B. and Hutto, R. 1978. Improving wood density of short rotation southern pine. TAPPI Journal, 61(3): 41-44
ASSESSMENT OF GENETIC DIVERSITY AMONG DALBERGIA SISSOO ROXB. CLONES OF NORTHERN INDIA AS REVEALED BY RAPD MARKERS
Shilpa Gautam, Subhash Nautiyal, U.S. Singh*and T.R. Sharma**
Forest Research Institute, Dehradun-248 006
* G.B.Pant University of Agriculture and Technology, Pantnagar-263 145
** CSK HP Agricultural University, Palampur-176 062
Introduction
D
albergia sissoo (Roxb.) locally known as shisham belongs to
family Fabaceae. There are many Dalbergia spp. grown in the
tropical regions of the world for veneer and lumber. It is one of the most important
multipurpose plantation trees of India. The area of natural distribution is the foothills
of the Himalayas from eastern Afghanistan through Pakistan and India to Nepal. Shisham has
delicate, light green, oval pointed leaflets and can quickly reach 60 feet in height with
a 40-foot spread. It grows naturally due to wide spreading seeds through wind. In its native
habitat, it grows up to 1500 m of elevation in the Himalaya foothills. It can withstand
occasional sub-freezing to light freezing temperatures. Shisham is an important timber tree;
the young branches and foliage are eaten by livestock. The leaves contain up to 24 per cent
crude protein (dry weight basis) and the dry matter digestibility is about 56 per cent. The
fodder value is highest in April and May when other sources of green fodder are scarce. After
teak, it is the most important cultivated timber tree in India, planted on roadsides, and as a
shade tree for tea plantations. It is used for cabinetry and furniture plywood, agricultural,
and musical instruments, skis, carvings, boats, floorings, etc. It also fixes atmospheric
nitrogen fixing and used in agroforestry systems with many crops. With its multiple products,
tolerance of light frosts and long dry seasons, the species deserves greater consideration for
agroforestry applications. Unfortunately, there is limited information available on the status
of genetic variability present in the Indian rosewood accessions which could be utilized for
its genetic improvement. The assessment of genetic diversity using morphological markers in
timber tree species like Dalbergia sissoo is difficult owing to their perennial nature and other
associated problems.
Traditionally, the estimation of genetic composition
of germplasm has been done on the basis of morphological and phenotypic characters, which are
time consuming and affected by environmental influences. Recently, molecular markers such as
RFLP, RAPD, SSR, ISSR and AFLP, etc. have been used to assess genetic variation in different
plant taxa, allowing estimation of degree of relatedness between individuals at the DNA level
without any influence of environmental variation. Among the various molecular techniques
available, RAPD (Williams et al., 1990; Welsh and Mc Clelland, 1990) analysis is simple, rapid
and reliable DNA fingerprinting method. Genetic relationship among Dalbergia species has been
studied using RAPD markers (Rout et el., 2003; Hiremath and Nagasampige, 2004). The purpose of
the present study was to use RAPD markers to assess genetic diversity among different genotypes
of shisham
Materials and Methods
Thirty diverse shisham accessions growing in the
Germplasm Block of Horticultural Research Centre, G.B. Pant University of Agriculture and
Technology, Pantnagar were used as experimental material (Table 1). Molecular work was done at
the Department of Plant Pathology, and Forest Genetics Laboratory of the Department of Genetics
and Plant Breeding of the G.B. Pant University of Agriculture and Technology, Pantnagar.
Genomic DNA from newly emerging leaves was extracted
using CTAB method (Murray and Thompson, 1980) with slight modification, where polyvinyl
pyrrolidone (PVP) was omitted from the procedure as fungi do not have interfering amounts of
phenolic compounds. Genomic DNA was quantified using UV spectrophotometer.
The PCR programme was set at initial cycle at 94oC for
5 minutes. Further amplification was repeated for 35 cycles consisting of denaturation at 94oC
for 1 minute and 72oC for 2 minutes, annealing at 36oC for 1 min and extension at 72oC for 2
minutes. Final extension of 7 minutes at 72oC was carried out before its rapid cooling to 4oC.
PCR products were visualized over an ultraviolet transilluminator and photographs of gels were
stored in Gel-Doc system.
Table 1. List of Dalbergia sissoo Roxb accessions used for DNA extraction
|
S.No. |
Genotype |
Origin/Source |
|
1 |
PS-1 |
Rishikesh, Dehradun(Uttrakhand) |
|
2 |
PS-2 |
Gangavihar, Rishikesh(Uttrakhand) |
|
3 |
PS-3 |
Shyampur, Haridwar(Haridwar) |
|
4 |
PS-4 |
Bajirgunj, Gonda(uttar Pradesh) |
|
5 |
PS-5 |
Kaldunghi, Nainital(Uttrakhand) |
|
6 |
PS-6 |
Gujpur, Ramnagar(Uttrakhand) |
|
7 |
PS-7 |
Vikrampur, Ramnagar(Uttrakhand) |
|
8 |
PS-8 |
Kaldunghi, Nainital(Uttrakhand) |
|
9 |
PS-9 |
Gonda(Uttar Pradesh) |
|
10 |
PS-10 |
Solan(Himachal Pradesh) |
|
11 |
PS-11 |
Tanda-Chhatarpur(uttrakhand) |
|
12 |
PS-12 |
Rohtak(Haryana) |
|
13 |
PS-13 |
Uttar Pradesh |
|
14 |
PS-14 |
Kukavalli, Etawah,(Uttar Pradesh) |
|
15 |
PS-15 |
Guara(himachal pradesh) |
|
16 |
PS-16 |
Kanke, Ranchi(Jharkhand) |
|
17 |
PS-17 |
Kanpur Dehat(Uttar Pradesh) |
|
18 |
PS-18 |
Mandar, Ranchi(Jharkhand) |
|
19 |
PS-19 |
Chidiapur, Bijnore(Uttar Pradesh) |
|
20 |
PS-20 |
Sisai Benijot, Gonda(Uttar Pradesh) |
|
21 |
PS-21 |
Jnakinagar, Gonda(Uttar Pradesh) |
|
22 |
PS-22 |
Ganganagar, Gonda(Uttar pradesh) |
|
23 |
PS-23 |
bhaihsadeeh, Gonda(Uttar Pradesh) |
|
24 |
PS-24 |
Barua Sagar, Jhansi(Uttar pradesh) |
|
25 |
PS-26 |
FRI-Dehradun |
|
26 |
PS-26 |
Majhola, Pillibhit(Uttar pradesh) |
|
27 |
PS-27 |
Fatehabad, Kanpur(Uttar pradesh) |
|
28 |
PS-28 |
Brahmdev- Nepal |
|
29 |
PS-29 |
Kanchanpur, Balrampur(Uttar Pradesh) |
|
30 |
PS-30 |
IGFRI, Jhansi (Uttar Pradesh) |
Because of the reported sensitivity of RAPD, the PCR
reactions were performed with utmost precision for the diversity analysis. Amplification
reactions were carried out under optimized reaction conditions. Amplification conditions were
kept identical for all the reactions. All PCR reactions were duplicated and only highly
reproducible bands were considered for genetic analysis. Of twenty-five primers tested, only
12 polymorphic and reproducible RAPD primers were used to generate similarity coefficients
among 30 germplasm lines of Dalbergia sissoo. The primer sequences are given in the Table 2.
The band data were scored and used to generate a binary matrix. The Numerical Taxonomy System of
Multivariate Statistical Program (NTSYS) software package was used for data analysis. Jaccard’s
similarity coefficient was used for construction of a dendrogram by the Unweighted Paired Group
Method of Arithmetic Averages (UPGMA).
Table 2. Primers used for PCR amplification and their GC content
|
Primers |
Primers Sequence |
GC(%) |
|
Primer-1 |
5'GGA CCC AAC C 3' |
70.0 |
|
Primer-2 |
5' GTC GCC GTC A 3' |
70.0 |
|
Primer-3 |
5' GTC TGC CCC A 3, |
70.0 |
|
Primer-4 |
5' AGA TGC AGC C 3' |
60.0 |
|
Primer-5 |
5' GTG AGG CGT C 3, |
70.0 |
|
Primer-6 |
5' GTG ACA TGC C 3' |
60.0 |
|
Primer-7 |
5, ACTCAGCCAC 3' |
60.0 |
|
Primer-8 |
5'GGGGGTTAGG 3, |
70.0 |
|
Primer-9 |
5' CCGCATCCTA 3' |
60.0 |
|
Primer-10 |
5' GTGTGCCCCA 3' |
70.0 |
|
Primer-11 |
5' TCGTTCCGCA 3' |
60.0 |
|
Primer-12 |
5' CAG GCC CTT C 3' |
70.0 |
|
Primers-13 |
5' ACC GCG AAG G 3' |
70.0 |
|
Primer-14 |
5' GTT TCG CTC C 3' |
60.0 |
|
Primer-15 |
5' CGTAGTGGTG 3, |
60.0 |
|
Primer-16 |
5' CGGTTTGGTC 3' |
60.0 |
|
Primer-17 |
5' GGACGATTCG 3' |
60.0 |
|
Primer-18 |
5' GAGGAGGAGGAGGAG 3' |
66.7 |
|
Primer-19 |
5' CATCATCATCATCAT 3' |
33.3 |
|
Primer-20 |
5' GACAGACAGACAGACA 3' |
50.0 |
|
Primer-21 |
5' TCTGGTGACC 3' |
60.0 |
|
Primer-22 |
5' GTGGTGGTGGTGGTG 3' |
66.7 |
|
Primer-23 |
5' GCAGAGCTAA 3' |
50.0 |
|
Primer-24 |
5' GATAGATAGATAGATAGATA 3' |
33.3 |
|
Primer-25 |
5' ACCGCGAAGG 3' |
70.0 |
Note. Primers-1 to Primer-12 were able to amplify the genomic DNA
Results and Discussion
he RAPD technique developed by Williams et al. (1990)
proved to be a simple, inexpensive and rapid way of fingerprinting plant accessions.
This technique has produced molecular data that have been very useful in taxonomic, phylogenic
and genetic diversity studies in many plant species. Of the 25 primers tested only 12 produced
easily identifiable polymorphic bands. The primer sequences and their respective G+C contents
are given in the Table 3. A total of 71 fragments were obtained using these primers, of which
68 (95.77 per cent) were polymorphic across accessions.
Table 3. Summary of RAPD amplified products obtained
|
Total primers used in the study |
25 |
|
Number of monomorphic primers |
01 |
|
Total number of bands amplified from polymorphic primers |
71 |
|
Size range of amplified products(in kb) |
0.470-2.00 |
|
Average number of bands per polymorphic primers |
5.91 |
|
Total number of polymorphic bands identified |
68 |
|
Average number of polymorphic bands per polymorphic primers |
5.66 |
|
Percentage of all bands that were polymorphic |
95.77 |
|
Total number of unique bands of identified |
01 |
|
Percentage of all bands that were unique |
1.4 |
|
Total number of bands |
2.0 |
An UPGMA dendrogram was constructed based on Jaccard’s
similarity indices (Figure 1). Four clusters were formed. Similarity coefficient ranged
from 0.429 to 0.795. The average number of polymorphic bands per primer was 5.66. The size of
amplified fragments ranged from 0.470 bp -2.00 kb. Accession PS 14 from Uttar Pradesh did not
cluster with any of the groups and formed its own out-group.
Fig.1. UPGMA dendrogram of 30 Dalbergia sissoo accessions generated by RAPD markers
The results of pair wise combinations indicated highest similarity (coefficient 0.795) between germplasm lines PS 19 and PS 22 from Uttar Pradesh. Similarly isolate PS 17 from Uttar Pradesh and PS 18 from Jharkhand exhibited high degree of similarity. Dendrogram readily separated 30 genotypes into four major clusters.
Cluster A comprised of 2 accessions (PS1 and PS 2, both
from Rishikesh, (Uttarakhand), while cluster B consisted of 10 genotypes (PS 3, PS 8, PS 10, PS
5, PS 11, PS 7, PS 12, PS 13, PS 4 and PS 9). Cluster C comprised of 15 genotypes (PS 6, PS 17,
PS 18, PS 30, PS 21, PS 24, PS 25, PS 19, PS 22, PS 20, PS 23, PS 16, PS 26, PS 15 and PS 29).
Cluster D had two genotypes (PS 27 and PS 28) one each from Uttar Pradesh and Nepal with
approximately 56 per cent similarity. This could possibly be due to the geographical proximity
of the regions. Germplasm accessions PS 1, PS 2, PS 4, PS 9, PS 14, PS 15, PS 27, PS 28 and PS
29 exhibited high genomic dissimilarity with other accessions. This implied the existence of
genetic diversity among germplasm accessions. One unique and reproducible band was obtained with
Primer 12 for the genotype PS 25. This indicated the possibility of identifying genotype
specific bands that could be used for identification of
duplicate accessions and gene bank management. More genotype specific bands need to be
identified for meaningful DNA fingerprinting of the accessions. The study demonstrated the
usefulness and |